\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319112030:

Variant ID: vg0319112030 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19112030
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACGCGACAAACAAACACCCAAGCAAAACATGCTATAAGTCTACTGAAACATGAAGCAAAACCATTTTCAATGGATTCTAGGGATTTTTATAAATTTACT[G/A]
AGACTTGAATTGACTTAAACGGAGCTCGGATGAATTAGTTATGATTTTTAGAAGATTATCTCTGTTTTTACTATAAAAAAGAAAAAGCCTTAATTATTTA

Reverse complement sequence

TAAATAATTAAGGCTTTTTCTTTTTTATAGTAAAAACAGAGATAATCTTCTAAAAATCATAACTAATTCATCCGAGCTCCGTTTAAGTCAATTCAAGTCT[C/T]
AGTAAATTTATAAAAATCCCTAGAATCCATTGAAAATGGTTTTGCTTCATGTTTCAGTAGACTTATAGCATGTTTTGCTTGGGTGTTTGTTTGTCGCGTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.80% 6.40% 1.52% 12.34% NA
All Indica  2759 71.50% 10.80% 2.17% 15.51% NA
All Japonica  1512 89.40% 0.00% 0.79% 9.79% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 57.60% 36.00% 3.70% 2.69% NA
Indica II  465 75.50% 3.70% 2.37% 18.49% NA
Indica III  913 71.70% 0.10% 1.42% 26.73% NA
Indica Intermediate  786 79.40% 8.40% 1.78% 10.43% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 73.00% 0.00% 2.18% 24.80% NA
Japonica Intermediate  241 90.00% 0.00% 0.41% 9.54% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 91.10% 4.40% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319112030 G -> A LOC_Os03g33450.1 upstream_gene_variant ; 298.0bp to feature; MODIFIER silent_mutation Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg0319112030 G -> A LOC_Os03g33460.1 downstream_gene_variant ; 2128.0bp to feature; MODIFIER silent_mutation Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg0319112030 G -> A LOC_Os03g33430-LOC_Os03g33450 intergenic_region ; MODIFIER silent_mutation Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N
vg0319112030 G -> DEL N N silent_mutation Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319112030 NA 4.59E-06 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0319112030 NA 6.34E-06 mr1038 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319112030 NA 1.73E-07 mr1106 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319112030 NA 3.16E-06 mr1106 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319112030 NA 1.01E-09 mr1215 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319112030 NA 6.68E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319112030 NA 8.41E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319112030 NA 8.62E-08 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251