\
| Variant ID: vg0319112030 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19112030 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TACGCGACAAACAAACACCCAAGCAAAACATGCTATAAGTCTACTGAAACATGAAGCAAAACCATTTTCAATGGATTCTAGGGATTTTTATAAATTTACT[G/A]
AGACTTGAATTGACTTAAACGGAGCTCGGATGAATTAGTTATGATTTTTAGAAGATTATCTCTGTTTTTACTATAAAAAAGAAAAAGCCTTAATTATTTA
TAAATAATTAAGGCTTTTTCTTTTTTATAGTAAAAACAGAGATAATCTTCTAAAAATCATAACTAATTCATCCGAGCTCCGTTTAAGTCAATTCAAGTCT[C/T]
AGTAAATTTATAAAAATCCCTAGAATCCATTGAAAATGGTTTTGCTTCATGTTTCAGTAGACTTATAGCATGTTTTGCTTGGGTGTTTGTTTGTCGCGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.80% | 6.40% | 1.52% | 12.34% | NA |
| All Indica | 2759 | 71.50% | 10.80% | 2.17% | 15.51% | NA |
| All Japonica | 1512 | 89.40% | 0.00% | 0.79% | 9.79% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 57.60% | 36.00% | 3.70% | 2.69% | NA |
| Indica II | 465 | 75.50% | 3.70% | 2.37% | 18.49% | NA |
| Indica III | 913 | 71.70% | 0.10% | 1.42% | 26.73% | NA |
| Indica Intermediate | 786 | 79.40% | 8.40% | 1.78% | 10.43% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 73.00% | 0.00% | 2.18% | 24.80% | NA |
| Japonica Intermediate | 241 | 90.00% | 0.00% | 0.41% | 9.54% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 91.10% | 4.40% | 0.00% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319112030 | G -> A | LOC_Os03g33450.1 | upstream_gene_variant ; 298.0bp to feature; MODIFIER | silent_mutation | Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg0319112030 | G -> A | LOC_Os03g33460.1 | downstream_gene_variant ; 2128.0bp to feature; MODIFIER | silent_mutation | Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg0319112030 | G -> A | LOC_Os03g33430-LOC_Os03g33450 | intergenic_region ; MODIFIER | silent_mutation | Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| vg0319112030 | G -> DEL | N | N | silent_mutation | Average:31.524; most accessible tissue: Zhenshan97 flag leaf, score: 71.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319112030 | NA | 4.59E-06 | Spikelet_length | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0319112030 | NA | 6.34E-06 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319112030 | NA | 1.73E-07 | mr1106 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319112030 | NA | 3.16E-06 | mr1106 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319112030 | NA | 1.01E-09 | mr1215 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319112030 | NA | 6.68E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319112030 | NA | 8.41E-08 | mr1439 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319112030 | NA | 8.62E-08 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |