Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319091716:

Variant ID: vg0319091716 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19091716
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATAAAGAATGGAAATATATTTTGCTCTGATAAACTCACATGGTTTTGAGCTACAATATATAAAATGTGCAATCATTTTGAGCCAAAAAATGGAGCATCA[A/T]
GAAGTGGGGCCCACATGTCAGCATCCTGAAGAAAGATGTGGGCCAGGGGAGCCAACCAGGGTGGTTCGGCCGAACCCCTAGCTGGCCCAGTCCAGCCCAT

Reverse complement sequence

ATGGGCTGGACTGGGCCAGCTAGGGGTTCGGCCGAACCACCCTGGTTGGCTCCCCTGGCCCACATCTTTCTTCAGGATGCTGACATGTGGGCCCCACTTC[T/A]
TGATGCTCCATTTTTTGGCTCAAAATGATTGCACATTTTATATATTGTAGCTCAAAACCATGTGAGTTTATCAGAGCAAAATATATTTCCATTCTTTATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	32.60%	0.53%	13.73%	NA
All Indica	2759	78.60%	3.50%	0.40%	17.47%	NA
All Japonica	1512	2.10%	86.60%	0.66%	10.65%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	92.90%	2.50%	0.50%	4.03%	NA
Indica II	465	74.40%	4.50%	0.22%	20.86%	NA
Indica III	913	69.40%	1.50%	0.44%	28.59%	NA
Indica Intermediate	786	80.90%	6.00%	0.38%	12.72%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	5.20%	65.90%	0.60%	28.37%	NA
Japonica Intermediate	241	1.70%	88.40%	2.90%	7.05%	NA
VI/Aromatic	96	27.10%	71.90%	0.00%	1.04%	NA
Intermediate	90	45.60%	44.40%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319091716	A -> T	LOC_Os03g33380.1	downstream_gene_variant ; 4073.0bp to feature; MODIFIER	silent_mutation	Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0319091716	A -> T	LOC_Os03g33390.1	downstream_gene_variant ; 1983.0bp to feature; MODIFIER	silent_mutation	Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0319091716	A -> T	LOC_Os03g33384.1	intron_variant ; MODIFIER	silent_mutation	Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0319091716	A -> DEL	N	N	silent_mutation	Average:24.881; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319091716	NA	5.70E-09	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	1.60E-10	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	3.59E-09	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	4.05E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	1.99E-06	1.43E-15	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	6.86E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	5.04E-06	5.03E-06	mr1987	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	1.23E-07	mr1004_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	1.56E-10	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	1.20E-13	mr1217_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	3.05E-06	1.19E-07	mr1217_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	1.51E-22	mr1386_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	4.81E-06	2.93E-12	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	1.17E-08	1.10E-151	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	6.09E-11	4.12E-31	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319091716	NA	4.41E-09	mr1987_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251