\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319088905:

Variant ID: vg0319088905 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19088905
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGGTATACAACAAAAGATTCACCATTACTATTACTCATACTTATCTCTAGTTGAGTCTGGCTTGATCATGCATGGTTATGCGTCCTCGGTCTATTTTC[A/G]
TATGTTATGGTTTGGGTGGTCGTCGACATTCATAGGCTTCTCAAATTAAGCATGATGCTTAGGATAAATAGCTTGCTTTAATCAAAGTTGACATGGTGTC

Reverse complement sequence

GACACCATGTCAACTTTGATTAAAGCAAGCTATTTATCCTAAGCATCATGCTTAATTTGAGAAGCCTATGAATGTCGACGACCACCCAAACCATAACATA[T/C]
GAAAATAGACCGAGGACGCATAACCATGCATGATCAAGCCAGACTCAACTAGAGATAAGTATGAGTAATAGTAATGGTGAATCTTTTGTTGTATACCTGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 32.70% 0.38% 13.88% NA
All Indica  2759 78.70% 3.40% 0.43% 17.43% NA
All Japonica  1512 2.00% 86.80% 0.40% 10.78% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 92.90% 2.50% 0.17% 4.37% NA
Indica II  465 74.60% 3.90% 0.43% 21.08% NA
Indica III  913 69.60% 1.80% 0.55% 28.15% NA
Indica Intermediate  786 80.90% 5.90% 0.51% 12.72% NA
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 5.00% 66.70% 0.79% 27.58% NA
Japonica Intermediate  241 1.20% 88.40% 0.83% 9.54% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 44.40% 45.60% 0.00% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319088905 A -> DEL N N silent_mutation Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0319088905 A -> G LOC_Os03g33380.1 downstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0319088905 A -> G LOC_Os03g33384.1 downstream_gene_variant ; 2496.0bp to feature; MODIFIER silent_mutation Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0319088905 A -> G LOC_Os03g33390.1 downstream_gene_variant ; 4794.0bp to feature; MODIFIER silent_mutation Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N
vg0319088905 A -> G LOC_Os03g33380-LOC_Os03g33384 intergenic_region ; MODIFIER silent_mutation Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319088905 NA 3.08E-10 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 2.00E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 4.57E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 4.20E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 6.25E-06 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 1.95E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 5.79E-06 9.35E-116 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 5.71E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 3.03E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 6.98E-13 mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 8.19E-06 2.46E-12 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 1.93E-24 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 1.08E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 5.60E-107 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 4.21E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 6.01E-07 NA mr1750_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905 NA 1.13E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251