Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319088905:

Variant ID: vg0319088905 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19088905
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TCAGGTATACAACAAAAGATTCACCATTACTATTACTCATACTTATCTCTAGTTGAGTCTGGCTTGATCATGCATGGTTATGCGTCCTCGGTCTATTTTC[A/G]
TATGTTATGGTTTGGGTGGTCGTCGACATTCATAGGCTTCTCAAATTAAGCATGATGCTTAGGATAAATAGCTTGCTTTAATCAAAGTTGACATGGTGTC

Reverse complement sequence

GACACCATGTCAACTTTGATTAAAGCAAGCTATTTATCCTAAGCATCATGCTTAATTTGAGAAGCCTATGAATGTCGACGACCACCCAAACCATAACATA[T/C]
GAAAATAGACCGAGGACGCATAACCATGCATGATCAAGCCAGACTCAACTAGAGATAAGTATGAGTAATAGTAATGGTGAATCTTTTGTTGTATACCTGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	32.70%	0.38%	13.88%	NA
All Indica	2759	78.70%	3.40%	0.43%	17.43%	NA
All Japonica	1512	2.00%	86.80%	0.40%	10.78%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	92.90%	2.50%	0.17%	4.37%	NA
Indica II	465	74.60%	3.90%	0.43%	21.08%	NA
Indica III	913	69.60%	1.80%	0.55%	28.15%	NA
Indica Intermediate	786	80.90%	5.90%	0.51%	12.72%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	5.00%	66.70%	0.79%	27.58%	NA
Japonica Intermediate	241	1.20%	88.40%	0.83%	9.54%	NA
VI/Aromatic	96	25.00%	71.90%	0.00%	3.12%	NA
Intermediate	90	44.40%	45.60%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319088905	A -> DEL	N	N	silent_mutation	Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0319088905	A -> G	LOC_Os03g33380.1	downstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0319088905	A -> G	LOC_Os03g33384.1	downstream_gene_variant ; 2496.0bp to feature; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0319088905	A -> G	LOC_Os03g33390.1	downstream_gene_variant ; 4794.0bp to feature; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N
vg0319088905	A -> G	LOC_Os03g33380-LOC_Os03g33384	intergenic_region ; MODIFIER	silent_mutation	Average:21.1; most accessible tissue: Zhenshan97 flower, score: 45.068	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319088905	NA	3.08E-10	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	2.00E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	4.57E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	4.20E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	6.25E-06	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	1.95E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	5.79E-06	9.35E-116	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	5.71E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	3.03E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	6.98E-13	mr1188_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	8.19E-06	2.46E-12	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	1.93E-24	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	1.08E-07	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	5.60E-107	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	4.21E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	6.01E-07	NA	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088905	NA	1.13E-13	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251