Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319088761:

Variant ID: vg0319088761 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19088761
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAACCACTCGCCTGAGTTGGCATGGTCAAAGTGCCTTCCTCCGCCACAACCTGCATCCAGATGGAGGAAAGAACAACAATCACATTTGACCGTGCCACCG[C/T]
TCCAAAGATTTCAACATATACATCATGCTGGCTGTAAATATACTCAGGTATACAACAAAAGATTCACCATTACTATTACTCATACTTATCTCTAGTTGAG

Reverse complement sequence

CTCAACTAGAGATAAGTATGAGTAATAGTAATGGTGAATCTTTTGTTGTATACCTGAGTATATTTACAGCCAGCATGATGTATATGTTGAAATCTTTGGA[G/A]
CGGTGGCACGGTCAAATGTGATTGTTGTTCTTTCCTCCATCTGGATGCAGGTTGTGGCGGAGGAAGGCACTTTGACCATGCCAACTCAGGCGAGTGGTTC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	32.60%	0.19%	14.20%	NA
All Indica	2759	78.70%	3.30%	0.33%	17.69%	NA
All Japonica	1512	2.10%	86.60%	0.00%	11.38%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	92.80%	2.40%	0.67%	4.20%	NA
Indica II	465	74.60%	3.90%	0.22%	21.29%	NA
Indica III	913	69.70%	1.50%	0.22%	28.59%	NA
Indica Intermediate	786	80.90%	5.70%	0.25%	13.10%	NA
Temperate Japonica	767	0.40%	99.50%	0.00%	0.13%	NA
Tropical Japonica	504	5.00%	66.10%	0.00%	28.97%	NA
Japonica Intermediate	241	1.20%	88.40%	0.00%	10.37%	NA
VI/Aromatic	96	25.00%	72.90%	0.00%	2.08%	NA
Intermediate	90	42.20%	47.80%	0.00%	10.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319088761	C -> T	LOC_Os03g33380.1	downstream_gene_variant ; 1118.0bp to feature; MODIFIER	silent_mutation	Average:29.51; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0319088761	C -> T	LOC_Os03g33384.1	downstream_gene_variant ; 2640.0bp to feature; MODIFIER	silent_mutation	Average:29.51; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0319088761	C -> T	LOC_Os03g33390.1	downstream_gene_variant ; 4938.0bp to feature; MODIFIER	silent_mutation	Average:29.51; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0319088761	C -> T	LOC_Os03g33380-LOC_Os03g33384	intergenic_region ; MODIFIER	silent_mutation	Average:29.51; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N
vg0319088761	C -> DEL	N	N	silent_mutation	Average:29.51; most accessible tissue: Zhenshan97 panicle, score: 59.59	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319088761	NA	1.62E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	5.60E-06	1.28E-42	mr1136	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	2.43E-07	4.56E-13	mr1136	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	2.57E-12	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	8.16E-07	8.50E-10	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	1.62E-11	mr1281	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	4.00E-06	3.10E-08	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	1.03E-19	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	2.67E-79	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	2.68E-115	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	4.46E-16	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	8.92E-16	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	2.10E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	5.67E-09	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	3.19E-13	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	1.88E-06	1.10E-12	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	5.73E-06	5.72E-06	mr1448_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	3.53E-115	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	7.43E-152	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	4.29E-14	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319088761	NA	3.90E-22	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251