Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319086476:

Variant ID: vg0319086476 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19086476
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATCCTTTTTACCTTTTTATTCAACCTCTACCCCTGCTATCCCATAGAAGTATTCCTGTTCAATCCTTCTCGACCATGGAGCAACCTCTCTTCGAGTTGTG[C/T]
GCTCCTCGGGACGAATTTTACGAGCCACCTCCTTCATCGGAGCCAATTTTAACACCTAGCTATGAAATTCGTATCGAATTCATCAGTATGGTTAGGGAGA

Reverse complement sequence

TCTCCCTAACCATACTGATGAATTCGATACGAATTTCATAGCTAGGTGTTAAAATTGGCTCCGATGAAGGAGGTGGCTCGTAAAATTCGTCCCGAGGAGC[G/A]
CACAACTCGAAGAGAGGTTGCTCCATGGTCGAGAAGGATTGAACAGGAATACTTCTATGGGATAGCAGGGGTAGAGGTTGAATAAAAAGGTAAAAAGGAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.10%	32.60%	0.34%	14.03%	NA
All Indica	2759	78.70%	3.40%	0.40%	17.54%	NA
All Japonica	1512	2.00%	86.60%	0.20%	11.18%	NA
Aus	269	90.30%	9.70%	0.00%	0.00%	NA
Indica I	595	93.10%	2.50%	0.17%	4.20%	NA
Indica II	465	74.60%	4.10%	0.22%	21.08%	NA
Indica III	913	69.40%	1.50%	0.77%	28.26%	NA
Indica Intermediate	786	80.90%	5.70%	0.25%	13.10%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	5.00%	66.30%	0.60%	28.17%	NA
Japonica Intermediate	241	1.20%	88.00%	0.00%	10.79%	NA
VI/Aromatic	96	25.00%	71.90%	1.04%	2.08%	NA
Intermediate	90	44.40%	45.60%	1.11%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319086476	C -> T	LOC_Os03g33384.1	downstream_gene_variant ; 4925.0bp to feature; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N
vg0319086476	C -> T	LOC_Os03g33380.1	intron_variant ; MODIFIER	silent_mutation	Average:23.558; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N
vg0319086476	C -> DEL	N	N	silent_mutation	Average:23.558; most accessible tissue: Zhenshan97 flag leaf, score: 53.795	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319086476	NA	2.53E-06	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	NA	2.95E-10	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	NA	1.24E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	NA	6.02E-08	mr1299_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	NA	6.48E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	9.26E-08	9.26E-08	mr1391_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	NA	7.80E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	1.12E-06	NA	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	1.89E-06	2.26E-10	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319086476	NA	2.41E-15	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251