\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319082948:

Variant ID: vg0319082948 (JBrowse)Variation Type: INDEL
Chromosome: chr03Position: 19082948
Reference Allele: CAAlternative Allele: TA,C
Primary Allele: TASecondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCTAGTGGTAATTAAGCAAGGCTAAGCATACATATAATTCTAGCAAGATCAACATAAGTATCACGAGCTAGATAAATTATCACCCAAGGTTGAGAAAGGA[CA/TA,C]
GATAACAAGTAAACATGGCACAAGCGAGCAGATAGGTAAACCCTATTCCCATGTAATTGGCAAAACATGCATATTTATTTGCAAACGGTAAAACATTTAT

Reverse complement sequence

ATAAATGTTTTACCGTTTGCAAATAAATATGCATGTTTTGCCAATTACATGGGAATAGGGTTTACCTATCTGCTCGCTTGTGCCATGTTTACTTGTTATC[TG/TA,G]
TCCTTTCTCAACCTTGGGTGATAATTTATCTAGCTCGTGATACTTATGTTGATCTTGCTAGAATTATATGTATGCTTAGCCTTGCTTAATTACCACTAGC

Allele Frequencies:

Populations Population SizeFrequency of TA(primary allele) Frequency of CA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.00% 34.00% 3.36% 9.29% C: 0.38%
All Indica  2759 78.60% 5.50% 5.47% 9.75% C: 0.65%
All Japonica  1512 2.00% 86.90% 0.40% 10.71% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 92.90% 3.00% 0.67% 3.36% NA
Indica II  465 74.20% 4.70% 3.44% 15.70% C: 1.94%
Indica III  913 69.40% 7.00% 12.27% 10.62% C: 0.66%
Indica Intermediate  786 81.00% 6.10% 2.42% 10.05% C: 0.38%
Temperate Japonica  767 0.30% 99.60% 0.00% 0.13% NA
Tropical Japonica  504 5.00% 67.10% 0.60% 27.38% NA
Japonica Intermediate  241 1.20% 88.00% 1.24% 9.54% NA
VI/Aromatic  96 25.00% 72.90% 0.00% 2.08% NA
Intermediate  90 43.30% 47.80% 2.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319082948 CA -> C LOC_Os03g33380.1 upstream_gene_variant ; 1413.0bp to feature; MODIFIER silent_mutation Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0319082948 CA -> C LOC_Os03g33370.1 downstream_gene_variant ; 2341.0bp to feature; MODIFIER silent_mutation Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0319082948 CA -> C LOC_Os03g33370-LOC_Os03g33380 intergenic_region ; MODIFIER silent_mutation Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0319082948 CA -> TA LOC_Os03g33380.1 upstream_gene_variant ; 1414.0bp to feature; MODIFIER silent_mutation Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0319082948 CA -> TA LOC_Os03g33370.1 downstream_gene_variant ; 2340.0bp to feature; MODIFIER silent_mutation Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0319082948 CA -> TA LOC_Os03g33370-LOC_Os03g33380 intergenic_region ; MODIFIER silent_mutation Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N
vg0319082948 CA -> DEL N N silent_mutation Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319082948 NA 1.99E-06 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 3.40E-10 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.97E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.88E-07 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 1.84E-07 2.12E-09 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 4.65E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 2.14E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.10E-78 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 5.90E-115 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 2.55E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.50E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.42E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.99E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 2.98E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 4.39E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.23E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 2.60E-06 8.81E-13 mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 6.45E-06 1.02E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 1.33E-06 7.34E-114 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.84E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 4.87E-14 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 1.27E-10 mr1893_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948 NA 6.10E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251