Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319082948:

Variant ID: vg0319082948 (JBrowse)	Variation Type: INDEL
Chromosome: chr03	Position: 19082948
Reference Allele: CA	Alternative Allele: TA,C
Primary Allele: TA	Secondary Allele: CA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTAGTGGTAATTAAGCAAGGCTAAGCATACATATAATTCTAGCAAGATCAACATAAGTATCACGAGCTAGATAAATTATCACCCAAGGTTGAGAAAGGA[CA/TA,C]
GATAACAAGTAAACATGGCACAAGCGAGCAGATAGGTAAACCCTATTCCCATGTAATTGGCAAAACATGCATATTTATTTGCAAACGGTAAAACATTTAT

Reverse complement sequence

ATAAATGTTTTACCGTTTGCAAATAAATATGCATGTTTTGCCAATTACATGGGAATAGGGTTTACCTATCTGCTCGCTTGTGCCATGTTTACTTGTTATC[TG/TA,G]
TCCTTTCTCAACCTTGGGTGATAATTTATCTAGCTCGTGATACTTATGTTGATCTTGCTAGAATTATATGTATGCTTAGCCTTGCTTAATTACCACTAGC

Allele Frequencies:

Populations	Population Size	Frequency of TA(primary allele)	Frequency of CA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.00%	34.00%	3.36%	9.29%	C: 0.38%
All Indica	2759	78.60%	5.50%	5.47%	9.75%	C: 0.65%
All Japonica	1512	2.00%	86.90%	0.40%	10.71%	NA
Aus	269	90.00%	10.00%	0.00%	0.00%	NA
Indica I	595	92.90%	3.00%	0.67%	3.36%	NA
Indica II	465	74.20%	4.70%	3.44%	15.70%	C: 1.94%
Indica III	913	69.40%	7.00%	12.27%	10.62%	C: 0.66%
Indica Intermediate	786	81.00%	6.10%	2.42%	10.05%	C: 0.38%
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	5.00%	67.10%	0.60%	27.38%	NA
Japonica Intermediate	241	1.20%	88.00%	1.24%	9.54%	NA
VI/Aromatic	96	25.00%	72.90%	0.00%	2.08%	NA
Intermediate	90	43.30%	47.80%	2.22%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319082948	CA -> C	LOC_Os03g33380.1	upstream_gene_variant ; 1413.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0319082948	CA -> C	LOC_Os03g33370.1	downstream_gene_variant ; 2341.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0319082948	CA -> C	LOC_Os03g33370-LOC_Os03g33380	intergenic_region ; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0319082948	CA -> TA	LOC_Os03g33380.1	upstream_gene_variant ; 1414.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0319082948	CA -> TA	LOC_Os03g33370.1	downstream_gene_variant ; 2340.0bp to feature; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0319082948	CA -> TA	LOC_Os03g33370-LOC_Os03g33380	intergenic_region ; MODIFIER	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N
vg0319082948	CA -> DEL	N	N	silent_mutation	Average:24.336; most accessible tissue: Zhenshan97 flag leaf, score: 44.637	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319082948	NA	1.99E-06	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	3.40E-10	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.97E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.88E-07	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	1.84E-07	2.12E-09	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	4.65E-20	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	2.14E-10	mr1630	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.10E-78	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	5.90E-115	mr1750	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	2.55E-06	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.50E-08	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.42E-16	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.99E-11	mr1902	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	2.98E-15	mr1933	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	4.39E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.23E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	2.60E-06	8.81E-13	mr1188_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	6.45E-06	1.02E-10	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	1.33E-06	7.34E-114	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.84E-11	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	4.87E-14	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	1.27E-10	mr1893_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319082948	NA	6.10E-22	mr1933_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251