\
| Variant ID: vg0319082408 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19082408 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TACCCTAGTGATCGAGGCTTGGGTAGTCCTCTCCATGGGCCGGCTCCCGCCTTGCCCACCCCTTGACGAAGGGGGCGTGCGGTGGCTTCGAGGTTGAGCA[C/G]
TGGAGTTGGGATCGCCTCAACGGGGAGTAGGAAACCGGCAAGTTGCCGAACCTCGGTGAAAAATCTCTTGTCTCCTTGTCTCATTTACTTGTTGCATTTA
TAAATGCAACAAGTAAATGAGACAAGGAGACAAGAGATTTTTCACCGAGGTTCGGCAACTTGCCGGTTTCCTACTCCCCGTTGAGGCGATCCCAACTCCA[G/C]
TGCTCAACCTCGAAGCCACCGCACGCCCCCTTCGTCAAGGGGTGGGCAAGGCGGGAGCCGGCCCATGGAGAGGACTACCCAAGCCTCGATCACTAGGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 32.50% | 0.25% | 14.22% | NA |
| All Indica | 2759 | 78.50% | 3.30% | 0.22% | 17.98% | NA |
| All Japonica | 1512 | 2.00% | 86.60% | 0.26% | 11.18% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 3.00% | 0.00% | 4.03% | NA |
| Indica II | 465 | 74.40% | 3.20% | 0.43% | 21.94% | NA |
| Indica III | 913 | 69.40% | 1.40% | 0.11% | 29.03% | NA |
| Indica Intermediate | 786 | 80.50% | 5.70% | 0.38% | 13.36% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 66.30% | 0.40% | 28.37% | NA |
| Japonica Intermediate | 241 | 1.20% | 87.60% | 0.41% | 10.79% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 45.60% | 46.70% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319082408 | C -> DEL | N | N | silent_mutation | Average:34.415; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0319082408 | C -> G | LOC_Os03g33380.1 | upstream_gene_variant ; 1954.0bp to feature; MODIFIER | silent_mutation | Average:34.415; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0319082408 | C -> G | LOC_Os03g33370.1 | downstream_gene_variant ; 1800.0bp to feature; MODIFIER | silent_mutation | Average:34.415; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| vg0319082408 | C -> G | LOC_Os03g33370-LOC_Os03g33380 | intergenic_region ; MODIFIER | silent_mutation | Average:34.415; most accessible tissue: Zhenshan97 flag leaf, score: 76.356 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319082408 | NA | 2.52E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 2.39E-10 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 1.78E-10 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 3.67E-08 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 8.55E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 9.70E-06 | mr1334 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | 4.31E-08 | 5.14E-10 | mr1448 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 2.57E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 4.45E-08 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | 6.33E-07 | 2.80E-117 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | 5.89E-11 | 2.94E-20 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 2.04E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | 4.10E-06 | 4.10E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 5.29E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | 2.97E-06 | 6.86E-12 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 4.73E-10 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 4.17E-11 | mr1722_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | 1.91E-07 | 1.50E-20 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 1.41E-13 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319082408 | NA | 1.92E-10 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |