\
| Variant ID: vg0319080537 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19080537 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CACCGATGTTGGAGACTTGAATGCTTCCATGGGGAGATTGCACACTAGAGTGGGTGCATTGGATTCTCGAGTCCAAATGTTGGAGAGCACCCAAGCTTTT[C/G]
TATATCATCGTCTTCCTGATGCTCCTCATCCTTCCTCTTCGGCGCGTCCTCCTTCTCCTCCACAAGAATGAAGACCTTTTTGGTACATGATGCCAAAAGG
CCTTTTGGCATCATGTACCAAAAAGGTCTTCATTCTTGTGGAGGAGAAGGAGGACGCGCCGAAGAGGAAGGATGAGGAGCATCAGGAAGACGATGATATA[G/C]
AAAAGCTTGGGTGCTCTCCAACATTTGGACTCGAGAATCCAATGCACCCACTCTAGTGTGCAATCTCCCCATGGAAGCATTCAAGTCTCCAACATCGGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 32.60% | 0.57% | 13.73% | NA |
| All Indica | 2759 | 78.70% | 3.30% | 0.83% | 17.14% | NA |
| All Japonica | 1512 | 2.00% | 86.80% | 0.07% | 11.18% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 3.20% | 0.00% | 3.87% | NA |
| Indica II | 465 | 74.80% | 3.20% | 1.94% | 20.00% | NA |
| Indica III | 913 | 69.70% | 1.60% | 0.33% | 28.37% | NA |
| Indica Intermediate | 786 | 80.70% | 5.50% | 1.40% | 12.47% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 66.70% | 0.20% | 28.17% | NA |
| Japonica Intermediate | 241 | 1.20% | 87.60% | 0.00% | 11.20% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 45.60% | 45.60% | 3.33% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319080537 | C -> DEL | LOC_Os03g33370.1 | N | frameshift_variant | Average:23.052; most accessible tissue: Zhenshan97 root, score: 51.776 | N | N | N | N |
| vg0319080537 | C -> G | LOC_Os03g33370.1 | missense_variant ; p.Leu393Val; MODERATE | nonsynonymous_codon ; L393V | Average:23.052; most accessible tissue: Zhenshan97 root, score: 51.776 | benign |
-0.504 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319080537 | 5.00E-08 | 1.19E-43 | mr1136 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | 1.93E-06 | 5.16E-12 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 7.69E-08 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 3.64E-12 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 6.46E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 8.28E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 1.09E-10 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | 9.74E-06 | 3.85E-09 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 2.51E-113 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | 3.45E-08 | 9.35E-17 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 1.09E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 1.12E-15 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 1.01E-11 | mr1902 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 8.93E-15 | mr1933 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | 1.60E-06 | 1.60E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 6.84E-10 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 1.26E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | 1.04E-06 | 1.04E-06 | mr1448_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | 2.92E-07 | 2.33E-21 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319080537 | NA | 4.20E-07 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |