\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319080537:

Variant ID: vg0319080537 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19080537
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CACCGATGTTGGAGACTTGAATGCTTCCATGGGGAGATTGCACACTAGAGTGGGTGCATTGGATTCTCGAGTCCAAATGTTGGAGAGCACCCAAGCTTTT[C/G]
TATATCATCGTCTTCCTGATGCTCCTCATCCTTCCTCTTCGGCGCGTCCTCCTTCTCCTCCACAAGAATGAAGACCTTTTTGGTACATGATGCCAAAAGG

Reverse complement sequence

CCTTTTGGCATCATGTACCAAAAAGGTCTTCATTCTTGTGGAGGAGAAGGAGGACGCGCCGAAGAGGAAGGATGAGGAGCATCAGGAAGACGATGATATA[G/C]
AAAAGCTTGGGTGCTCTCCAACATTTGGACTCGAGAATCCAATGCACCCACTCTAGTGTGCAATCTCCCCATGGAAGCATTCAAGTCTCCAACATCGGTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 32.60% 0.57% 13.73% NA
All Indica  2759 78.70% 3.30% 0.83% 17.14% NA
All Japonica  1512 2.00% 86.80% 0.07% 11.18% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 92.90% 3.20% 0.00% 3.87% NA
Indica II  465 74.80% 3.20% 1.94% 20.00% NA
Indica III  913 69.70% 1.60% 0.33% 28.37% NA
Indica Intermediate  786 80.70% 5.50% 1.40% 12.47% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 66.70% 0.20% 28.17% NA
Japonica Intermediate  241 1.20% 87.60% 0.00% 11.20% NA
VI/Aromatic  96 25.00% 72.90% 0.00% 2.08% NA
Intermediate  90 45.60% 45.60% 3.33% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319080537 C -> DEL LOC_Os03g33370.1 N frameshift_variant Average:23.052; most accessible tissue: Zhenshan97 root, score: 51.776 N N N N
vg0319080537 C -> G LOC_Os03g33370.1 missense_variant ; p.Leu393Val; MODERATE nonsynonymous_codon ; L393V Average:23.052; most accessible tissue: Zhenshan97 root, score: 51.776 benign -0.504 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319080537 5.00E-08 1.19E-43 mr1136 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 1.93E-06 5.16E-12 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 7.69E-08 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 3.64E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 6.46E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 8.28E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 1.09E-10 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 9.74E-06 3.85E-09 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 2.51E-113 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 3.45E-08 9.35E-17 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 1.09E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 1.12E-15 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 1.01E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 8.93E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 1.60E-06 1.60E-06 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 6.84E-10 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 1.26E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 1.04E-06 1.04E-06 mr1448_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 2.92E-07 2.33E-21 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319080537 NA 4.20E-07 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251