\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319079517:

Variant ID: vg0319079517 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19079517
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATCGCAGTATACCATCTTGAGGCATCATGATCAGTTCTTGAGGCCTCGAGACACCCTGGATCCCCGTTTTCACACCGCTTTCCAGAAGACTGTGTATGA[A/G]
CAGGTTTATGCAGGGAAAGCATTTGCAAAGCATAAGTGGATTTCTTGGAGAGACATCAATGAGACTCCAGAGTTTGAGAGCTTGCAGGATCTCTTCAAGA

Reverse complement sequence

TCTTGAAGAGATCCTGCAAGCTCTCAAACTCTGGAGTCTCATTGATGTCTCTCCAAGAAATCCACTTATGCTTTGCAAATGCTTTCCCTGCATAAACCTG[T/C]
TCATACACAGTCTTCTGGAAAGCGGTGTGAAAACGGGGATCCAGGGTGTCTCGAGGCCTCAAGAACTGATCATGATGCCTCAAGATGGTATACTGCGATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.40% 33.20% 0.42% 13.99% NA
All Indica  2759 77.50% 4.50% 0.47% 17.58% NA
All Japonica  1512 2.10% 86.60% 0.26% 11.11% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 90.10% 5.50% 0.34% 4.03% NA
Indica II  465 74.40% 3.90% 0.43% 21.29% NA
Indica III  913 69.60% 1.60% 0.44% 28.37% NA
Indica Intermediate  786 79.00% 7.30% 0.64% 13.10% NA
Temperate Japonica  767 0.40% 99.50% 0.13% 0.00% NA
Tropical Japonica  504 5.00% 66.50% 0.40% 28.17% NA
Japonica Intermediate  241 1.20% 87.60% 0.41% 10.79% NA
VI/Aromatic  96 25.00% 72.90% 0.00% 2.08% NA
Intermediate  90 43.30% 46.70% 3.33% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319079517 A -> DEL LOC_Os03g33370.1 N frameshift_variant Average:30.915; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N
vg0319079517 A -> G LOC_Os03g33370.1 synonymous_variant ; p.Glu113Glu; LOW synonymous_codon Average:30.915; most accessible tissue: Zhenshan97 flag leaf, score: 64.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319079517 3.88E-06 NA mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 1.02E-06 1.96E-12 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 3.17E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 1.19E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 9.38E-21 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 3.06E-07 1.94E-11 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 2.86E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 1.57E-13 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 3.35E-08 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 1.56E-06 1.57E-06 mr1834 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 7.30E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 2.07E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 1.12E-08 mr1050_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 2.00E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 9.14E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 1.30E-12 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 4.84E-11 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 3.85E-06 1.19E-19 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 NA 4.33E-22 mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079517 4.52E-06 3.17E-09 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251