\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319079018:

Variant ID: vg0319079018 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19079018
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGGATGCTTAAACTTGTGGGAGGAGGTCTGCCTGGAGACACAAGCGGTTTGACCATGGGTCAGCCGCCGGTCTGACCGGCCGGCAGCCGTCGGTCTGAC[T/C]
GGCCACCATGGGCGGTCTGACCGGCCTGATGCCTTCGGTCTGACCACCCTACTGGCTGCGGTCTGACCACCCCTCCACAGGATGTAGGCAAATTTTTACC

Reverse complement sequence

GGTAAAAATTTGCCTACATCCTGTGGAGGGGTGGTCAGACCGCAGCCAGTAGGGTGGTCAGACCGAAGGCATCAGGCCGGTCAGACCGCCCATGGTGGCC[A/G]
GTCAGACCGACGGCTGCCGGCCGGTCAGACCGGCGGCTGACCCATGGTCAAACCGCTTGTGTCTCCAGGCAGACCTCCTCCCACAAGTTTAAGCATCCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.10% 32.70% 0.63% 13.54% NA
All Indica  2759 78.60% 3.40% 0.87% 17.07% NA
All Japonica  1512 2.10% 86.80% 0.40% 10.71% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 92.90% 3.20% 0.17% 3.70% NA
Indica II  465 74.80% 3.40% 0.65% 21.08% NA
Indica III  913 69.60% 1.60% 1.64% 27.16% NA
Indica Intermediate  786 80.50% 5.70% 0.64% 13.10% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 66.70% 0.99% 27.38% NA
Japonica Intermediate  241 1.70% 88.00% 0.41% 9.96% NA
VI/Aromatic  96 25.00% 72.90% 0.00% 2.08% NA
Intermediate  90 47.80% 46.70% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319079018 T -> C LOC_Os03g33370.1 upstream_gene_variant ; 158.0bp to feature; MODIFIER silent_mutation Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0319079018 T -> C LOC_Os03g33360.1 downstream_gene_variant ; 1859.0bp to feature; MODIFIER silent_mutation Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0319079018 T -> C LOC_Os03g33360-LOC_Os03g33370 intergenic_region ; MODIFIER silent_mutation Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N
vg0319079018 T -> DEL N N silent_mutation Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319079018 2.29E-06 NA mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 1.08E-06 1.98E-12 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 NA 3.53E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 NA 1.15E-11 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 NA 1.37E-19 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 4.70E-06 1.93E-09 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 4.01E-06 1.27E-13 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 2.48E-06 2.48E-06 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 NA 2.01E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 NA 9.27E-10 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 6.86E-06 1.40E-18 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319079018 6.96E-07 2.38E-10 mr1987_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251