\
| Variant ID: vg0319079018 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19079018 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGGATGCTTAAACTTGTGGGAGGAGGTCTGCCTGGAGACACAAGCGGTTTGACCATGGGTCAGCCGCCGGTCTGACCGGCCGGCAGCCGTCGGTCTGAC[T/C]
GGCCACCATGGGCGGTCTGACCGGCCTGATGCCTTCGGTCTGACCACCCTACTGGCTGCGGTCTGACCACCCCTCCACAGGATGTAGGCAAATTTTTACC
GGTAAAAATTTGCCTACATCCTGTGGAGGGGTGGTCAGACCGCAGCCAGTAGGGTGGTCAGACCGAAGGCATCAGGCCGGTCAGACCGCCCATGGTGGCC[A/G]
GTCAGACCGACGGCTGCCGGCCGGTCAGACCGGCGGCTGACCCATGGTCAAACCGCTTGTGTCTCCAGGCAGACCTCCTCCCACAAGTTTAAGCATCCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.10% | 32.70% | 0.63% | 13.54% | NA |
| All Indica | 2759 | 78.60% | 3.40% | 0.87% | 17.07% | NA |
| All Japonica | 1512 | 2.10% | 86.80% | 0.40% | 10.71% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.90% | 3.20% | 0.17% | 3.70% | NA |
| Indica II | 465 | 74.80% | 3.40% | 0.65% | 21.08% | NA |
| Indica III | 913 | 69.60% | 1.60% | 1.64% | 27.16% | NA |
| Indica Intermediate | 786 | 80.50% | 5.70% | 0.64% | 13.10% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 66.70% | 0.99% | 27.38% | NA |
| Japonica Intermediate | 241 | 1.70% | 88.00% | 0.41% | 9.96% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 47.80% | 46.70% | 0.00% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319079018 | T -> C | LOC_Os03g33370.1 | upstream_gene_variant ; 158.0bp to feature; MODIFIER | silent_mutation | Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0319079018 | T -> C | LOC_Os03g33360.1 | downstream_gene_variant ; 1859.0bp to feature; MODIFIER | silent_mutation | Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0319079018 | T -> C | LOC_Os03g33360-LOC_Os03g33370 | intergenic_region ; MODIFIER | silent_mutation | Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| vg0319079018 | T -> DEL | N | N | silent_mutation | Average:35.526; most accessible tissue: Zhenshan97 flag leaf, score: 77.203 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319079018 | 2.29E-06 | NA | mr1136 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | 1.08E-06 | 1.98E-12 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | NA | 3.53E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | NA | 1.15E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | NA | 1.37E-19 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | 4.70E-06 | 1.93E-09 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | 4.01E-06 | 1.27E-13 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | 2.48E-06 | 2.48E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | NA | 2.01E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | NA | 9.27E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | 6.86E-06 | 1.40E-18 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319079018 | 6.96E-07 | 2.38E-10 | mr1987_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |