\
| Variant ID: vg0319057447 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19057447 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGCGTAACCTGCGTCATCACTCCGGCCATTATGCAAGAAGAAGACAAGTCACTCGCCTTGTGGTCACTGGAGCAAACGCCATACCTGTGAGGCCTCGTG[C/T]
TAATCATAACCCATAGCAGAAACAATGTACCGATGCTAAGCACCTTTCCTTTTTTTTAGGCAGTGCTTAGTATTCATGTAATAAGGGAGAAATGTATAAT
ATTATACATTTCTCCCTTATTACATGAATACTAAGCACTGCCTAAAAAAAAGGAAAGGTGCTTAGCATCGGTACATTGTTTCTGCTATGGGTTATGATTA[G/A]
CACGAGGCCTCACAGGTATGGCGTTTGCTCCAGTGACCACAAGGCGAGTGACTTGTCTTCTTCTTGCATAATGGCCGGAGTGATGACGCAGGTTACGCTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.70% | 32.50% | 0.47% | 6.33% | NA |
| All Indica | 2759 | 91.10% | 3.20% | 0.36% | 5.40% | NA |
| All Japonica | 1512 | 3.00% | 86.70% | 0.66% | 9.66% | NA |
| Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.50% | 2.00% | 0.17% | 0.34% | NA |
| Indica II | 465 | 95.70% | 3.20% | 0.00% | 1.08% | NA |
| Indica III | 913 | 84.00% | 1.60% | 0.77% | 13.58% | NA |
| Indica Intermediate | 786 | 91.70% | 5.70% | 0.25% | 2.29% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.50% | 66.30% | 0.79% | 25.40% | NA |
| Japonica Intermediate | 241 | 2.10% | 88.00% | 2.49% | 7.47% | NA |
| VI/Aromatic | 96 | 26.00% | 71.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 46.70% | 48.90% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319057447 | C -> T | LOC_Os03g33328.1 | upstream_gene_variant ; 2274.0bp to feature; MODIFIER | silent_mutation | Average:43.237; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg0319057447 | C -> T | LOC_Os03g33310.1 | downstream_gene_variant ; 4359.0bp to feature; MODIFIER | silent_mutation | Average:43.237; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg0319057447 | C -> T | LOC_Os03g33319.1 | intron_variant ; MODIFIER | silent_mutation | Average:43.237; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| vg0319057447 | C -> DEL | N | N | silent_mutation | Average:43.237; most accessible tissue: Minghui63 flag leaf, score: 64.867 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319057447 | NA | 3.97E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 5.03E-11 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | 5.27E-07 | 1.10E-07 | mr1188 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 3.85E-11 | mr1281 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 2.43E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 1.49E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 4.78E-11 | mr1630 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 6.16E-115 | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 4.36E-16 | mr1842 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 3.88E-12 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 1.29E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 4.35E-06 | mr1217_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 2.43E-24 | mr1588_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | 8.22E-06 | 1.39E-151 | mr1750_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319057447 | NA | 1.26E-12 | mr1770_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |