\
| Variant ID: vg0319043512 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19043512 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTGTGAGCATTACTCGTTTGTGTCTTCTCTTGAACCTTTAAGGGTGGAAGAATCTTTTAATGATCCGGATTGGGTGATGGCGATGCAAGAGGAGCTGAA[C/T]
AATTTCACCCGGAATGAAGTGTGGACTTTGGTGGAGCGACCTCGGCAAAACGTGATTGGCATGAAGTGGATCTTCCGCAACAAGCAAGACGAGGCCGGGG
CCCCGGCCTCGTCTTGCTTGTTGCGGAAGATCCACTTCATGCCAATCACGTTTTGCCGAGGTCGCTCCACCAAAGTCCACACTTCATTCCGGGTGAAATT[G/A]
TTCAGCTCCTCTTGCATCGCCATCACCCAATCCGGATCATTAAAAGATTCTTCCACCCTTAAAGGTTCAAGAGAAGACACAAACGAGTAATGCTCACAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.00% | 33.00% | 0.78% | 13.20% | NA |
| All Indica | 2759 | 78.70% | 4.30% | 1.12% | 15.84% | NA |
| All Japonica | 1512 | 1.90% | 86.20% | 0.26% | 11.64% | NA |
| Aus | 269 | 89.20% | 10.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 93.10% | 3.50% | 0.67% | 2.69% | NA |
| Indica II | 465 | 74.40% | 5.20% | 1.51% | 18.92% | NA |
| Indica III | 913 | 69.40% | 1.80% | 1.86% | 26.94% | NA |
| Indica Intermediate | 786 | 81.20% | 7.40% | 0.38% | 11.07% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 66.30% | 0.40% | 28.37% | NA |
| Japonica Intermediate | 241 | 0.80% | 84.60% | 0.83% | 13.69% | NA |
| VI/Aromatic | 96 | 25.00% | 71.90% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 46.70% | 44.40% | 2.22% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319043512 | C -> T | LOC_Os03g33300.1 | synonymous_variant ; p.Asn8Asn; LOW | synonymous_codon | Average:24.426; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| vg0319043512 | C -> DEL | LOC_Os03g33300.1 | N | frameshift_variant | Average:24.426; most accessible tissue: Zhenshan97 flag leaf, score: 46.427 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319043512 | NA | 7.32E-08 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | NA | 5.38E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | NA | 8.94E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | 7.64E-07 | 3.39E-12 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | 2.67E-08 | NA | mr1750 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | 2.98E-10 | 1.52E-18 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | 3.30E-06 | 3.30E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | NA | 2.78E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | 8.70E-06 | 8.70E-06 | mr1448_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | NA | 6.39E-12 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319043512 | 3.29E-06 | 1.86E-19 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |