\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319031415:

Variant ID: vg0319031415 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19031415
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:


CGTTGTTTTAGCCGCCGCCGTCGCCGGCGATCCTCCGGTCGCGTCGCGCTGCCGCTAGTATCGTCGCCGCTGCCGTCCGTCGTCACAGTCGGGTTCGTGA[G/T]
GAGGAGAGGAATCCCGTCCGCCCCTTCGCAGCCGCCGAAGACCGCCGGAGCGTCGCCGTCGGGGACCCGAGTCGAGCCGCCGTTGAACCTCGTCGCCGGC

Reverse complement sequence

GCCGGCGACGAGGTTCAACGGCGGCTCGACTCGGGTCCCCGACGGCGACGCTCCGGCGGTCTTCGGCGGCTGCGAAGGGGCGGACGGGATTCCTCTCCTC[C/A]
TCACGAACCCGACTGTGACGACGGACGGCAGCGGCGACGATACTAGCGGCAGCGCGACGCGACCGGAGGATCGCCGGCGACGGCGGCGGCTAAAACAACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.30% 0.30% 0.04% 0.36% NA
All Indica  2759 99.60% 0.40% 0.04% 0.04% NA
All Japonica  1512 98.90% 0.00% 0.00% 1.06% NA
Aus  269 98.90% 0.70% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.40% 0.13% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 93.80% 0.00% 0.00% 6.22% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319031415 G -> T LOC_Os03g33260.1 upstream_gene_variant ; 1683.0bp to feature; MODIFIER silent_mutation Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0319031415 G -> T LOC_Os03g33280.1 upstream_gene_variant ; 2996.0bp to feature; MODIFIER silent_mutation Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0319031415 G -> T LOC_Os03g33270.1 downstream_gene_variant ; 1557.0bp to feature; MODIFIER silent_mutation Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0319031415 G -> T LOC_Os03g33260-LOC_Os03g33270 intergenic_region ; MODIFIER silent_mutation Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N
vg0319031415 G -> DEL N N silent_mutation Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319031415 NA 1.62E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415 NA 4.41E-06 mr1011 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415 NA 6.51E-06 mr1012 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415 3.70E-06 3.69E-06 mr1340 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415 6.01E-06 5.99E-06 mr1429 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415 5.52E-06 NA mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415 NA 8.15E-07 mr1038_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415 NA 5.73E-07 mr1038_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251