Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319031415:

Variant ID: vg0319031415 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 19031415
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 49. )

Flanking Sequence (100 bp) in Reference Genome:

CGTTGTTTTAGCCGCCGCCGTCGCCGGCGATCCTCCGGTCGCGTCGCGCTGCCGCTAGTATCGTCGCCGCTGCCGTCCGTCGTCACAGTCGGGTTCGTGA[G/T]
GAGGAGAGGAATCCCGTCCGCCCCTTCGCAGCCGCCGAAGACCGCCGGAGCGTCGCCGTCGGGGACCCGAGTCGAGCCGCCGTTGAACCTCGTCGCCGGC

Reverse complement sequence

GCCGGCGACGAGGTTCAACGGCGGCTCGACTCGGGTCCCCGACGGCGACGCTCCGGCGGTCTTCGGCGGCTGCGAAGGGGCGGACGGGATTCCTCTCCTC[C/A]
TCACGAACCCGACTGTGACGACGGACGGCAGCGGCGACGATACTAGCGGCAGCGCGACGCGACCGGAGGATCGCCGGCGACGGCGGCGGCTAAAACAACG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	99.30%	0.30%	0.04%	0.36%	NA
All Indica	2759	99.60%	0.40%	0.04%	0.04%	NA
All Japonica	1512	98.90%	0.00%	0.00%	1.06%	NA
Aus	269	98.90%	0.70%	0.37%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	99.10%	0.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.40%	0.40%	0.13%	0.13%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.00%	0.00%	0.20%	NA
Japonica Intermediate	241	93.80%	0.00%	0.00%	6.22%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	100.00%	0.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0319031415	G -> T	LOC_Os03g33260.1	upstream_gene_variant ; 1683.0bp to feature; MODIFIER	silent_mutation	Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0319031415	G -> T	LOC_Os03g33280.1	upstream_gene_variant ; 2996.0bp to feature; MODIFIER	silent_mutation	Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0319031415	G -> T	LOC_Os03g33270.1	downstream_gene_variant ; 1557.0bp to feature; MODIFIER	silent_mutation	Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0319031415	G -> T	LOC_Os03g33260-LOC_Os03g33270	intergenic_region ; MODIFIER	silent_mutation	Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N
vg0319031415	G -> DEL	N	N	silent_mutation	Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0319031415	NA	1.62E-06	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415	NA	4.41E-06	mr1011	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415	NA	6.51E-06	mr1012	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415	3.70E-06	3.69E-06	mr1340	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415	6.01E-06	5.99E-06	mr1429	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415	5.52E-06	NA	mr1683	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415	NA	8.15E-07	mr1038_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319031415	NA	5.73E-07	mr1038_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251