\
| Variant ID: vg0319031415 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 19031415 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, others allele: 0.00, population size: 49. )
CGTTGTTTTAGCCGCCGCCGTCGCCGGCGATCCTCCGGTCGCGTCGCGCTGCCGCTAGTATCGTCGCCGCTGCCGTCCGTCGTCACAGTCGGGTTCGTGA[G/T]
GAGGAGAGGAATCCCGTCCGCCCCTTCGCAGCCGCCGAAGACCGCCGGAGCGTCGCCGTCGGGGACCCGAGTCGAGCCGCCGTTGAACCTCGTCGCCGGC
GCCGGCGACGAGGTTCAACGGCGGCTCGACTCGGGTCCCCGACGGCGACGCTCCGGCGGTCTTCGGCGGCTGCGAAGGGGCGGACGGGATTCCTCTCCTC[C/A]
TCACGAACCCGACTGTGACGACGGACGGCAGCGGCGACGATACTAGCGGCAGCGCGACGCGACCGGAGGATCGCCGGCGACGGCGGCGGCTAAAACAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.30% | 0.30% | 0.04% | 0.36% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.04% | 0.04% | NA |
| All Japonica | 1512 | 98.90% | 0.00% | 0.00% | 1.06% | NA |
| Aus | 269 | 98.90% | 0.70% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.00% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0319031415 | G -> T | LOC_Os03g33260.1 | upstream_gene_variant ; 1683.0bp to feature; MODIFIER | silent_mutation | Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0319031415 | G -> T | LOC_Os03g33280.1 | upstream_gene_variant ; 2996.0bp to feature; MODIFIER | silent_mutation | Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0319031415 | G -> T | LOC_Os03g33270.1 | downstream_gene_variant ; 1557.0bp to feature; MODIFIER | silent_mutation | Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0319031415 | G -> T | LOC_Os03g33260-LOC_Os03g33270 | intergenic_region ; MODIFIER | silent_mutation | Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| vg0319031415 | G -> DEL | N | N | silent_mutation | Average:22.493; most accessible tissue: Zhenshan97 flower, score: 41.495 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0319031415 | NA | 1.62E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319031415 | NA | 4.41E-06 | mr1011 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319031415 | NA | 6.51E-06 | mr1012 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319031415 | 3.70E-06 | 3.69E-06 | mr1340 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319031415 | 6.01E-06 | 5.99E-06 | mr1429 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319031415 | 5.52E-06 | NA | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319031415 | NA | 8.15E-07 | mr1038_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0319031415 | NA | 5.73E-07 | mr1038_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |