Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0319004736:

Variant ID: vg0319004736 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 19004736
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, G: 0.08, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


TCGCGGGGGCGAACTTATCATGGCGAAGTCGTCTTCCCTCGGCGGATAGTCTTTGCCTTGCACCCTTCGCTTGAGACGCCTCTGGCCCGGCAAGGCACTC[A/G]
TACGACTCTTCGCCTCACGCCATTCTTGCTCCATAGCCTACGCCACGGGTTTCGGCAGACTTGGTTGAAGGGCCTCATGCCATCCGCCAACAGATGGTAA

Reverse complement sequence

TTACCATCTGTTGGCGGATGGCATGAGGCCCTTCAACCAAGTCTGCCGAAACCCGTGGCGTAGGCTATGGAGCAAGAATGGCGTGAGGCGAAGAGTCGTA[T/C]
GAGTGCCTTGCCGGGCCAGAGGCGTCTCAAGCGAAGGGTGCAAGGCAAAGACTATCCGCCGAGGGAAGACGACTTCGCCATGATAAGTTCGCCCCCGCGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.90% 7.60% 0.97% 6.56% NA
All Indica  2759 81.40% 6.50% 0.91% 11.16% NA
All Japonica  1512 87.60% 11.20% 1.26% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 95.30% 3.20% 0.00% 1.51% NA
Indica II  465 77.80% 15.30% 0.43% 6.45% NA
Indica III  913 71.10% 3.10% 1.64% 24.21% NA
Indica Intermediate  786 85.10% 7.80% 1.02% 6.11% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 69.40% 30.40% 0.20% 0.00% NA
Japonica Intermediate  241 85.90% 6.60% 7.47% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 87.80% 8.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0319004736 A -> DEL N N silent_mutation Average:33.346; most accessible tissue: Callus, score: 78.609 N N N N
vg0319004736 A -> G LOC_Os03g33230.1 upstream_gene_variant ; 535.0bp to feature; MODIFIER silent_mutation Average:33.346; most accessible tissue: Callus, score: 78.609 N N N N
vg0319004736 A -> G LOC_Os03g33230-LOC_Os03g33240 intergenic_region ; MODIFIER silent_mutation Average:33.346; most accessible tissue: Callus, score: 78.609 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0319004736 NA 7.87E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 1.93E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 8.36E-06 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 1.04E-06 NA mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 4.32E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 1.26E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 9.33E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 3.17E-06 NA mr1861 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 1.51E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 5.80E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0319004736 NA 4.70E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251