\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318987746:

Variant ID: vg0318987746 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18987746
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.82, A: 0.18, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGAGGTGCATCAGCCACGAACGCGCAGAACCTTTCAACGCTGTCGGCAAATAGTTTGCTAACGCATTGTCATCTGCTCCGGCAGCGTATAGTACTGTG[G/A]
AGTAGACCTGAAGGAATTCTTCTGGGTCGGTACTCCCATCGTACTTCTCTATTGCCCCAGGTCGGAATCTCTCAGGACATCGGACATCACGTAGGGAACG

Reverse complement sequence

CGTTCCCTACGTGATGTCCGATGTCCTGAGAGATTCCGACCTGGGGCAATAGAGAAGTACGATGGGAGTACCGACCCAGAAGAATTCCTTCAGGTCTACT[C/T]
CACAGTACTATACGCTGCCGGAGCAGATGACAATGCGTTAGCAAACTATTTGCCGACAGCGTTGAAAGGTTCTGCGCGTTCGTGGCTGATGCACCTCCCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 33.20% 0.34% 6.67% NA
All Indica  2759 84.30% 3.70% 0.54% 11.38% NA
All Japonica  1512 12.80% 87.20% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 95.80% 2.40% 0.17% 1.68% NA
Indica II  465 89.50% 3.90% 0.65% 6.02% NA
Indica III  913 71.70% 2.80% 0.88% 24.53% NA
Indica Intermediate  786 87.30% 5.70% 0.38% 6.62% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.70% 0.00% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 46.70% 51.10% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318987746 G -> A LOC_Os03g33172.1 upstream_gene_variant ; 4898.0bp to feature; MODIFIER silent_mutation Average:36.939; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0318987746 G -> A LOC_Os03g33200.1 downstream_gene_variant ; 2434.0bp to feature; MODIFIER silent_mutation Average:36.939; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0318987746 G -> A LOC_Os03g33190.1 intron_variant ; MODIFIER silent_mutation Average:36.939; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0318987746 G -> DEL N N silent_mutation Average:36.939; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318987746 NA 5.59E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 6.19E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 4.59E-07 mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 1.38E-08 1.17E-13 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 1.57E-08 9.51E-19 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 4.24E-15 mr1933 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 9.39E-07 9.39E-07 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 3.94E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 9.51E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 9.03E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 1.12E-07 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 5.98E-12 1.51E-20 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 2.81E-13 1.93E-32 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318987746 NA 4.96E-08 mr1987_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251