\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318954218:

Variant ID: vg0318954218 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18954218
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, A: 0.23, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTACCTTGCCTCCTGGGACAAGGAATAATACATGCACGTAAGGAACGCCCGTTGGGTTAATTCCGGTCGTGACAAGTTGGTATCAGAGCCCCCTTGAC[A/C]
CTAGGACGAGCCGTAGATCCCAAGCCTTAGCAATATTTTCAAAATAAAAATCCTTTCTTATTTGTGAAAATCCTCTAGTCTCTCTCTGTCCTGCTGCTTC

Reverse complement sequence

GAAGCAGCAGGACAGAGAGAGACTAGAGGATTTTCACAAATAAGAAAGGATTTTTATTTTGAAAATATTGCTAAGGCTTGGGATCTACGGCTCGTCCTAG[T/G]
GTCAAGGGGGCTCTGATACCAACTTGTCACGACCGGAATTAACCCAACGGGCGTTCCTTACGTGCATGTATTATTCCTTGTCCCAGGAGGCAAGGTACAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.40% 22.90% 39.93% 13.82% NA
All Indica  2759 3.70% 25.00% 51.11% 20.19% NA
All Japonica  1512 57.70% 8.40% 28.37% 5.49% NA
Aus  269 10.00% 83.60% 4.09% 2.23% NA
Indica I  595 3.40% 26.20% 44.03% 26.39% NA
Indica II  465 3.40% 16.30% 55.48% 24.73% NA
Indica III  913 2.50% 30.20% 55.31% 11.94% NA
Indica Intermediate  786 5.60% 23.00% 48.98% 22.39% NA
Temperate Japonica  767 58.70% 0.10% 34.16% 7.04% NA
Tropical Japonica  504 57.50% 18.80% 21.63% 1.98% NA
Japonica Intermediate  241 55.20% 12.90% 24.07% 7.88% NA
VI/Aromatic  96 68.80% 24.00% 6.25% 1.04% NA
Intermediate  90 40.00% 18.90% 34.44% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318954218 A -> C LOC_Os03g33140.1 upstream_gene_variant ; 3346.0bp to feature; MODIFIER silent_mutation Average:7.74; most accessible tissue: Callus, score: 30.658 N N N N
vg0318954218 A -> C LOC_Os03g33110.1 downstream_gene_variant ; 4092.0bp to feature; MODIFIER silent_mutation Average:7.74; most accessible tissue: Callus, score: 30.658 N N N N
vg0318954218 A -> C LOC_Os03g33130.1 intron_variant ; MODIFIER silent_mutation Average:7.74; most accessible tissue: Callus, score: 30.658 N N N N
vg0318954218 A -> DEL N N silent_mutation Average:7.74; most accessible tissue: Callus, score: 30.658 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318954218 NA 3.05E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 7.07E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 3.14E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.80E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 5.42E-07 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 9.98E-06 mr1075_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 4.86E-25 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 4.43E-09 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 2.74E-06 mr1091_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 8.13E-07 mr1126_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.58E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.49E-06 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 5.81E-08 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.34E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 3.62E-08 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.55E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 6.26E-12 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 5.04E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 5.67E-06 mr1596_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 8.52E-10 mr1771_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 5.71E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.12E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 3.35E-06 3.21E-12 mr1784_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.60E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 7.14E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.05E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 1.07E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 3.51E-42 mr1862_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 6.05E-11 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318954218 NA 7.09E-06 mr1923_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251