\
| Variant ID: vg0318942572 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18942572 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATGGGCACAACTTCATGTATATTGTGCAGACTGTAAAAAGTAAGATAAACCATGTAGCACTTCCCCACTATGAGCCCATGCTTCATGGTGGCAGAGCCGA[C/T]
CTTAGTGGCATCAAGGGCCCATATGGGTGATGTCCATAAAACAAAGGACATCCAAAACGACACTTCAGGGTCGTGCAGAAGGTTCGTTTGCCTCCGATAT
ATATCGGAGGCAAACGAACCTTCTGCACGACCCTGAAGTGTCGTTTTGGATGTCCTTTGTTTTATGGACATCACCCATATGGGCCCTTGATGCCACTAAG[G/A]
TCGGCTCTGCCACCATGAAGCATGGGCTCATAGTGGGGAAGTGCTACATGGTTTATCTTACTTTTTACAGTCTGCACAATATACATGAAGTTGTGCCCAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 9.20% | 4.32% | 0.51% | NA |
| All Indica | 2759 | 77.30% | 15.40% | 7.21% | 0.11% | NA |
| All Japonica | 1512 | 98.50% | 0.30% | 0.07% | 1.19% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 75.00% | 8.10% | 16.97% | 0.00% | NA |
| Indica II | 465 | 94.00% | 1.30% | 4.73% | 0.00% | NA |
| Indica III | 913 | 70.50% | 27.90% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 77.00% | 14.80% | 7.89% | 0.38% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.10% | 0.40% | 0.00% | 7.47% | NA |
| VI/Aromatic | 96 | 96.90% | 0.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 90.00% | 6.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318942572 | C -> T | LOC_Os03g33100.1 | N | splice_donor_variant | Average:45.889; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| vg0318942572 | C -> DEL | LOC_Os03g33100.1 | N | splice_donor_variant | Average:45.889; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318942572 | NA | 1.95E-08 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | 4.26E-06 | NA | mr1314 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | NA | 2.46E-09 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | NA | 3.18E-07 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | NA | 2.73E-06 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | NA | 1.81E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | NA | 7.07E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | NA | 7.46E-06 | mr1269_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | NA | 8.94E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318942572 | 3.43E-06 | 3.43E-06 | mr1912_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |