\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318928238:

Variant ID: vg0318928238 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18928238
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.76, A: 0.24, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


AGTGTGAAGTTCTCCTGACCATATGCATCCCAAGTTTCCACACCCTCTTTCCACAGAATCTCAAGGTCATCGATAACAGGCTCCAAGAACACATCGATGT[A/C]
ATTGCCGGGTTGTCTCGGACCTTGGATTAACAAGCACAACATAATATATTTCCTTTTGAAGCACAACCATGGTGGGAGGTTAAAGTTCGCAATGAGAACT

Reverse complement sequence

AGTTCTCATTGCGAACTTTAACCTCCCACCATGGTTGTGCTTCAAAAGGAAATATATTATGTTGTGCTTGTTAATCCAAGGTCCGAGACAACCCGGCAAT[T/G]
ACATCGATGTGTTCTTGGAGCCTGTTATCGATGACCTTGAGATTCTGTGGAAAGAGGGTGTGGAAACTTGGGATGCATATGGTCAGGAGAACTTCACACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.50% 15.00% 0.49% 0.04% NA
All Indica  2759 80.50% 19.40% 0.18% 0.00% NA
All Japonica  1512 87.60% 11.20% 1.12% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.60% 5.40% 0.00% 0.00% NA
Indica II  465 76.80% 23.00% 0.22% 0.00% NA
Indica III  913 70.20% 29.80% 0.00% 0.00% NA
Indica Intermediate  786 83.80% 15.60% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 69.40% 30.40% 0.20% 0.00% NA
Japonica Intermediate  241 85.90% 6.60% 6.64% 0.83% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318928238 A -> C LOC_Os03g33080.1 missense_variant ; p.Tyr247Asp; MODERATE nonsynonymous_codon ; Y247D Average:35.934; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 probably damaging -2.931 TOLERATED 1.00
vg0318928238 A -> DEL LOC_Os03g33080.1 N frameshift_variant Average:35.934; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318928238 NA 5.74E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 5.57E-06 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 1.03E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 8.35E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 9.15E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 6.06E-10 4.09E-12 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 8.30E-06 2.08E-08 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 6.20E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 1.71E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 9.51E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 1.29E-07 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 4.91E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 9.43E-07 mr1243_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 1.24E-06 mr1295_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318928238 NA 1.24E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251