\
| Variant ID: vg0318829113 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18829113 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.73, C: 0.27, others allele: 0.00, population size: 45. )
ATGGCACGGGGACATGGTCCGAGTCGAGGAGAGAGATCTTGCTAAGGTCGTTGGTGATGAAGTTGAAACTGCCGAACCGGAACGCCTGCCCGGGAGGGAA[C/G]
GCGAAGTCGTCGATGCCAGAAACGAAACCCATCGCACTTAGTCGGTGAGAACTTGACGCTACCCCTACCTGGCGCACCAACTGTCGAAACAAGATTTCGA
TCGAAATCTTGTTTCGACAGTTGGTGCGCCAGGTAGGGGTAGCGTCAAGTTCTCACCGACTAAGTGCGATGGGTTTCGTTTCTGGCATCGACGACTTCGC[G/C]
TTCCCTCCCGGGCAGGCGTTCCGGTTCGGCAGTTTCAACTTCATCACCAACGACCTTAGCAAGATCTCTCTCCTCGACTCGGACCATGTCCCCGTGCCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.40% | 32.90% | 0.95% | 19.76% | NA |
| All Indica | 2759 | 69.20% | 4.00% | 1.41% | 25.41% | NA |
| All Japonica | 1512 | 12.60% | 85.70% | 0.13% | 1.59% | NA |
| Aus | 269 | 21.60% | 12.30% | 0.74% | 65.43% | NA |
| Indica I | 595 | 58.00% | 4.90% | 1.18% | 35.97% | NA |
| Indica II | 465 | 41.50% | 4.70% | 3.87% | 49.89% | NA |
| Indica III | 913 | 91.90% | 1.30% | 0.33% | 6.46% | NA |
| Indica Intermediate | 786 | 67.60% | 6.10% | 1.40% | 24.94% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 33.90% | 65.50% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 7.10% | 83.80% | 0.00% | 9.13% | NA |
| VI/Aromatic | 96 | 4.20% | 71.90% | 1.04% | 22.92% | NA |
| Intermediate | 90 | 35.60% | 51.10% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318829113 | C -> DEL | LOC_Os03g32930.1 | N | frameshift_variant | Average:33.387; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0318829113 | C -> G | LOC_Os03g32930.1 | synonymous_variant ; p.Ala313Ala; LOW | synonymous_codon | Average:33.387; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
| vg0318829113 | C -> G | LOC_Os03g32930.1 | synonymous_variant ; p.Ala313Ala; LOW | nonsynonymous_codon ; A313T | Average:33.387; most accessible tissue: Minghui63 young leaf, score: 61.887 | benign |
0.381 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318829113 | NA | 3.38E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 1.48E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 2.41E-06 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 4.09E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 7.10E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 4.05E-07 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 1.76E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 7.97E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 5.39E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 2.99E-06 | mr1505_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 9.02E-09 | mr1612_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 3.82E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 5.75E-06 | mr1771_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 5.62E-08 | mr1783_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | 5.96E-06 | NA | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 6.31E-09 | mr1785_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 4.08E-09 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 1.84E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 3.29E-11 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318829113 | NA | 3.81E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |