\
| Variant ID: vg0318828127 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18828127 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, A: 0.07, T: 0.07, others allele: 0.00, population size: 54. )
CTCGGCGCTCCCTGTGACGTTCGGGAGGCGAGTGAACAGATCGTTCGTCGTGACCCCTGCTCCTGCGATTAGATCCTATGCCGATGATGCTGAGGCTTGG[C/T]
TGATGATAATCATGAGATCGGAGGTGAGGGACTCGGCTACCGGTCGGGGTGCGGGTGCTTGCGGAGTTGGCTAGAACCGAGGCAACGATCATGGTCTTCG
CGAAGACCATGATCGTTGCCTCGGTTCTAGCCAACTCCGCAAGCACCCGCACCCCGACCGGTAGCCGAGTCCCTCACCTCCGATCTCATGATTATCATCA[G/A]
CCAAGCCTCAGCATCATCGGCATAGGATCTAATCGCAGGAGCAGGGGTCACGACGAACGATCTGTTCACTCGCCTCCCGAACGTCACAGGGAGCGCCGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.80% | 29.80% | 3.39% | 28.02% | NA |
| All Indica | 2759 | 9.30% | 48.10% | 4.02% | 38.60% | NA |
| All Japonica | 1512 | 86.90% | 0.70% | 0.40% | 12.04% | NA |
| Aus | 269 | 51.70% | 17.10% | 14.13% | 17.10% | NA |
| Indica I | 595 | 7.90% | 51.30% | 2.18% | 38.66% | NA |
| Indica II | 465 | 8.20% | 17.20% | 6.45% | 68.17% | NA |
| Indica III | 913 | 9.60% | 60.00% | 4.05% | 26.29% | NA |
| Indica Intermediate | 786 | 10.60% | 50.10% | 3.94% | 35.37% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 68.80% | 1.40% | 1.19% | 28.57% | NA |
| Japonica Intermediate | 241 | 84.20% | 0.40% | 0.00% | 15.35% | NA |
| VI/Aromatic | 96 | 77.10% | 3.10% | 5.21% | 14.58% | NA |
| Intermediate | 90 | 57.80% | 23.30% | 0.00% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318828127 | C -> T | LOC_Os03g32920.1 | upstream_gene_variant ; 1158.0bp to feature; MODIFIER | silent_mutation | Average:7.971; most accessible tissue: Callus, score: 27.069 | N | N | N | N |
| vg0318828127 | C -> T | LOC_Os03g32910.1 | downstream_gene_variant ; 4546.0bp to feature; MODIFIER | silent_mutation | Average:7.971; most accessible tissue: Callus, score: 27.069 | N | N | N | N |
| vg0318828127 | C -> T | LOC_Os03g32940.1 | downstream_gene_variant ; 4950.0bp to feature; MODIFIER | silent_mutation | Average:7.971; most accessible tissue: Callus, score: 27.069 | N | N | N | N |
| vg0318828127 | C -> T | LOC_Os03g32930.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.971; most accessible tissue: Callus, score: 27.069 | N | N | N | N |
| vg0318828127 | C -> DEL | N | N | silent_mutation | Average:7.971; most accessible tissue: Callus, score: 27.069 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318828127 | 1.81E-06 | 1.02E-07 | mr1214 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 2.26E-06 | mr1231 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 1.72E-07 | mr1232 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 2.06E-06 | mr1306 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 1.34E-06 | mr1327 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 2.98E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 7.70E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 3.21E-07 | mr1771 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318828127 | NA | 8.08E-07 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |