\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318828127:

Variant ID: vg0318828127 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18828127
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, A: 0.07, T: 0.07, others allele: 0.00, population size: 54. )

Flanking Sequence (100 bp) in Reference Genome:


CTCGGCGCTCCCTGTGACGTTCGGGAGGCGAGTGAACAGATCGTTCGTCGTGACCCCTGCTCCTGCGATTAGATCCTATGCCGATGATGCTGAGGCTTGG[C/T]
TGATGATAATCATGAGATCGGAGGTGAGGGACTCGGCTACCGGTCGGGGTGCGGGTGCTTGCGGAGTTGGCTAGAACCGAGGCAACGATCATGGTCTTCG

Reverse complement sequence

CGAAGACCATGATCGTTGCCTCGGTTCTAGCCAACTCCGCAAGCACCCGCACCCCGACCGGTAGCCGAGTCCCTCACCTCCGATCTCATGATTATCATCA[G/A]
CCAAGCCTCAGCATCATCGGCATAGGATCTAATCGCAGGAGCAGGGGTCACGACGAACGATCTGTTCACTCGCCTCCCGAACGTCACAGGGAGCGCCGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.80% 29.80% 3.39% 28.02% NA
All Indica  2759 9.30% 48.10% 4.02% 38.60% NA
All Japonica  1512 86.90% 0.70% 0.40% 12.04% NA
Aus  269 51.70% 17.10% 14.13% 17.10% NA
Indica I  595 7.90% 51.30% 2.18% 38.66% NA
Indica II  465 8.20% 17.20% 6.45% 68.17% NA
Indica III  913 9.60% 60.00% 4.05% 26.29% NA
Indica Intermediate  786 10.60% 50.10% 3.94% 35.37% NA
Temperate Japonica  767 99.60% 0.30% 0.00% 0.13% NA
Tropical Japonica  504 68.80% 1.40% 1.19% 28.57% NA
Japonica Intermediate  241 84.20% 0.40% 0.00% 15.35% NA
VI/Aromatic  96 77.10% 3.10% 5.21% 14.58% NA
Intermediate  90 57.80% 23.30% 0.00% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318828127 C -> T LOC_Os03g32920.1 upstream_gene_variant ; 1158.0bp to feature; MODIFIER silent_mutation Average:7.971; most accessible tissue: Callus, score: 27.069 N N N N
vg0318828127 C -> T LOC_Os03g32910.1 downstream_gene_variant ; 4546.0bp to feature; MODIFIER silent_mutation Average:7.971; most accessible tissue: Callus, score: 27.069 N N N N
vg0318828127 C -> T LOC_Os03g32940.1 downstream_gene_variant ; 4950.0bp to feature; MODIFIER silent_mutation Average:7.971; most accessible tissue: Callus, score: 27.069 N N N N
vg0318828127 C -> T LOC_Os03g32930.1 intron_variant ; MODIFIER silent_mutation Average:7.971; most accessible tissue: Callus, score: 27.069 N N N N
vg0318828127 C -> DEL N N silent_mutation Average:7.971; most accessible tissue: Callus, score: 27.069 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318828127 1.81E-06 1.02E-07 mr1214 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 2.26E-06 mr1231 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 1.72E-07 mr1232 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 2.06E-06 mr1306 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 1.34E-06 mr1327 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 2.98E-06 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 7.70E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 3.21E-07 mr1771 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318828127 NA 8.08E-07 mr1002_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251