\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318823675:

Variant ID: vg0318823675 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18823675
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATTGATATAACAATAATTTTGATGATTAATGATGACGGAGGCACAATTTGTACAATACTGATGAATTTATGCTATGCTTGATATCTTAACTTAGTTCC[T/C]
GATTTCTTAAAAGTTTTTGTCAAACCTTGTTGATCCTAAAACCCACAAAAGTTGTTAAAAAACTTTCAGTCCTCATTGACTAAGCCAAGAAATCAAACAG

Reverse complement sequence

CTGTTTGATTTCTTGGCTTAGTCAATGAGGACTGAAAGTTTTTTAACAACTTTTGTGGGTTTTAGGATCAACAAGGTTTGACAAAAACTTTTAAGAAATC[A/G]
GGAACTAAGTTAAGATATCAAGCATAGCATAAATTCATCAGTATTGTACAAATTGTGCCTCCGTCATCATTAATCATCAAAATTATTGTTATATCAATCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.30% 3.10% 4.36% 7.26% NA
All Indica  2759 79.50% 5.30% 6.74% 8.48% NA
All Japonica  1512 98.50% 0.00% 0.07% 1.39% NA
Aus  269 70.30% 0.40% 5.58% 23.79% NA
Indica I  595 70.80% 5.40% 6.55% 17.31% NA
Indica II  465 59.80% 11.60% 18.92% 9.68% NA
Indica III  913 95.20% 1.90% 0.99% 1.97% NA
Indica Intermediate  786 79.60% 5.30% 6.36% 8.65% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 92.10% 0.00% 0.00% 7.88% NA
VI/Aromatic  96 80.20% 0.00% 2.08% 17.71% NA
Intermediate  90 90.00% 0.00% 2.22% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318823675 T -> C LOC_Os03g32910.1 downstream_gene_variant ; 94.0bp to feature; MODIFIER silent_mutation Average:14.549; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0318823675 T -> C LOC_Os03g32920.1 downstream_gene_variant ; 1468.0bp to feature; MODIFIER silent_mutation Average:14.549; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0318823675 T -> C LOC_Os03g32930.1 downstream_gene_variant ; 3450.0bp to feature; MODIFIER silent_mutation Average:14.549; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0318823675 T -> C LOC_Os03g32910-LOC_Os03g32920 intergenic_region ; MODIFIER silent_mutation Average:14.549; most accessible tissue: Minghui63 root, score: 25.504 N N N N
vg0318823675 T -> DEL N N silent_mutation Average:14.549; most accessible tissue: Minghui63 root, score: 25.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318823675 9.64E-06 NA mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318823675 1.95E-06 NA mr1352_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318823675 4.09E-06 NA mr1671_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251