\
| Variant ID: vg0318809268 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18809268 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GGGGCGTCTCGGGCGATGGGTGCAAGGCGAAGACTATCTGCCGAAGGAAGACGACTTCGCCATGGCAAGTTCGCCCCCGCAAGGGCCGAGGAAGCCTTTC[C/A]
GGCCCATCAAGCCTAAGGGCCGGCAATCGCTAGATGGCCCATCAGGGGCCCATGAGACCCTATAACATTATGTACCCCTGTAAATGTCCCTTTCATAAGG
CCTTATGAAAGGGACATTTACAGGGGTACATAATGTTATAGGGTCTCATGGGCCCCTGATGGGCCATCTAGCGATTGCCGGCCCTTAGGCTTGATGGGCC[G/T]
GAAAGGCTTCCTCGGCCCTTGCGGGGGCGAACTTGCCATGGCGAAGTCGTCTTCCTTCGGCAGATAGTCTTCGCCTTGCACCCATCGCCCGAGACGCCCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.30% | 32.00% | 0.17% | 1.57% | NA |
| All Indica | 2759 | 97.10% | 2.60% | 0.18% | 0.14% | NA |
| All Japonica | 1512 | 12.80% | 85.80% | 0.00% | 1.39% | NA |
| Aus | 269 | 70.60% | 11.50% | 0.37% | 17.47% | NA |
| Indica I | 595 | 97.50% | 2.40% | 0.17% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 4.50% | 0.13% | 0.51% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.30% | 65.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.50% | 84.20% | 0.00% | 8.30% | NA |
| VI/Aromatic | 96 | 25.00% | 72.90% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 50.00% | 47.80% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318809268 | C -> A | LOC_Os03g32870.1 | upstream_gene_variant ; 3932.0bp to feature; MODIFIER | silent_mutation | Average:31.578; most accessible tissue: Callus, score: 39.05 | N | N | N | N |
| vg0318809268 | C -> A | LOC_Os03g32880.1 | downstream_gene_variant ; 939.0bp to feature; MODIFIER | silent_mutation | Average:31.578; most accessible tissue: Callus, score: 39.05 | N | N | N | N |
| vg0318809268 | C -> A | LOC_Os03g32890.1 | downstream_gene_variant ; 1834.0bp to feature; MODIFIER | silent_mutation | Average:31.578; most accessible tissue: Callus, score: 39.05 | N | N | N | N |
| vg0318809268 | C -> A | LOC_Os03g32880-LOC_Os03g32890 | intergenic_region ; MODIFIER | silent_mutation | Average:31.578; most accessible tissue: Callus, score: 39.05 | N | N | N | N |
| vg0318809268 | C -> DEL | N | N | silent_mutation | Average:31.578; most accessible tissue: Callus, score: 39.05 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318809268 | NA | 8.80E-19 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 1.73E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 5.75E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | 1.58E-06 | 1.61E-10 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 1.06E-11 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 5.12E-09 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 6.70E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 5.04E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 9.15E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | 1.75E-09 | 6.94E-15 | mr1718_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318809268 | NA | 2.72E-20 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |