Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318809268:

Variant ID: vg0318809268 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18809268
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGGGCGTCTCGGGCGATGGGTGCAAGGCGAAGACTATCTGCCGAAGGAAGACGACTTCGCCATGGCAAGTTCGCCCCCGCAAGGGCCGAGGAAGCCTTTC[C/A]
GGCCCATCAAGCCTAAGGGCCGGCAATCGCTAGATGGCCCATCAGGGGCCCATGAGACCCTATAACATTATGTACCCCTGTAAATGTCCCTTTCATAAGG

Reverse complement sequence

CCTTATGAAAGGGACATTTACAGGGGTACATAATGTTATAGGGTCTCATGGGCCCCTGATGGGCCATCTAGCGATTGCCGGCCCTTAGGCTTGATGGGCC[G/T]
GAAAGGCTTCCTCGGCCCTTGCGGGGGCGAACTTGCCATGGCGAAGTCGTCTTCCTTCGGCAGATAGTCTTCGCCTTGCACCCATCGCCCGAGACGCCCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	66.30%	32.00%	0.17%	1.57%	NA
All Indica	2759	97.10%	2.60%	0.18%	0.14%	NA
All Japonica	1512	12.80%	85.80%	0.00%	1.39%	NA
Aus	269	70.60%	11.50%	0.37%	17.47%	NA
Indica I	595	97.50%	2.40%	0.17%	0.00%	NA
Indica II	465	97.20%	2.60%	0.22%	0.00%	NA
Indica III	913	98.70%	1.10%	0.22%	0.00%	NA
Indica Intermediate	786	94.90%	4.50%	0.13%	0.51%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	34.30%	65.50%	0.00%	0.20%	NA
Japonica Intermediate	241	7.50%	84.20%	0.00%	8.30%	NA
VI/Aromatic	96	25.00%	72.90%	0.00%	2.08%	NA
Intermediate	90	50.00%	47.80%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318809268	C -> A	LOC_Os03g32870.1	upstream_gene_variant ; 3932.0bp to feature; MODIFIER	silent_mutation	Average:31.578; most accessible tissue: Callus, score: 39.05	N	N	N	N
vg0318809268	C -> A	LOC_Os03g32880.1	downstream_gene_variant ; 939.0bp to feature; MODIFIER	silent_mutation	Average:31.578; most accessible tissue: Callus, score: 39.05	N	N	N	N
vg0318809268	C -> A	LOC_Os03g32890.1	downstream_gene_variant ; 1834.0bp to feature; MODIFIER	silent_mutation	Average:31.578; most accessible tissue: Callus, score: 39.05	N	N	N	N
vg0318809268	C -> A	LOC_Os03g32880-LOC_Os03g32890	intergenic_region ; MODIFIER	silent_mutation	Average:31.578; most accessible tissue: Callus, score: 39.05	N	N	N	N
vg0318809268	C -> DEL	N	N	silent_mutation	Average:31.578; most accessible tissue: Callus, score: 39.05	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318809268	NA	8.80E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	1.73E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	5.75E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	1.58E-06	1.61E-10	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	1.06E-11	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	5.12E-09	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	6.70E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	5.04E-07	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	9.15E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	1.75E-09	6.94E-15	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268	NA	2.72E-20	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251