\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318809268:

Variant ID: vg0318809268 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18809268
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGGGCGTCTCGGGCGATGGGTGCAAGGCGAAGACTATCTGCCGAAGGAAGACGACTTCGCCATGGCAAGTTCGCCCCCGCAAGGGCCGAGGAAGCCTTTC[C/A]
GGCCCATCAAGCCTAAGGGCCGGCAATCGCTAGATGGCCCATCAGGGGCCCATGAGACCCTATAACATTATGTACCCCTGTAAATGTCCCTTTCATAAGG

Reverse complement sequence

CCTTATGAAAGGGACATTTACAGGGGTACATAATGTTATAGGGTCTCATGGGCCCCTGATGGGCCATCTAGCGATTGCCGGCCCTTAGGCTTGATGGGCC[G/T]
GAAAGGCTTCCTCGGCCCTTGCGGGGGCGAACTTGCCATGGCGAAGTCGTCTTCCTTCGGCAGATAGTCTTCGCCTTGCACCCATCGCCCGAGACGCCCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 32.00% 0.17% 1.57% NA
All Indica  2759 97.10% 2.60% 0.18% 0.14% NA
All Japonica  1512 12.80% 85.80% 0.00% 1.39% NA
Aus  269 70.60% 11.50% 0.37% 17.47% NA
Indica I  595 97.50% 2.40% 0.17% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 98.70% 1.10% 0.22% 0.00% NA
Indica Intermediate  786 94.90% 4.50% 0.13% 0.51% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.50% 84.20% 0.00% 8.30% NA
VI/Aromatic  96 25.00% 72.90% 0.00% 2.08% NA
Intermediate  90 50.00% 47.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318809268 C -> A LOC_Os03g32870.1 upstream_gene_variant ; 3932.0bp to feature; MODIFIER silent_mutation Average:31.578; most accessible tissue: Callus, score: 39.05 N N N N
vg0318809268 C -> A LOC_Os03g32880.1 downstream_gene_variant ; 939.0bp to feature; MODIFIER silent_mutation Average:31.578; most accessible tissue: Callus, score: 39.05 N N N N
vg0318809268 C -> A LOC_Os03g32890.1 downstream_gene_variant ; 1834.0bp to feature; MODIFIER silent_mutation Average:31.578; most accessible tissue: Callus, score: 39.05 N N N N
vg0318809268 C -> A LOC_Os03g32880-LOC_Os03g32890 intergenic_region ; MODIFIER silent_mutation Average:31.578; most accessible tissue: Callus, score: 39.05 N N N N
vg0318809268 C -> DEL N N silent_mutation Average:31.578; most accessible tissue: Callus, score: 39.05 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318809268 NA 8.80E-19 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 1.73E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 5.75E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 1.58E-06 1.61E-10 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 1.06E-11 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 5.12E-09 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 6.70E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 5.04E-07 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 9.15E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 1.75E-09 6.94E-15 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318809268 NA 2.72E-20 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251