\
| Variant ID: vg0318766245 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18766245 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTTTGGTTATACAGGGGAATTTACATGGTTACCCTTATGAAAGGGACATTTACATGGGTACATAGGGTAATTGAGGTTCACAGGCCCCTGATGGGCCGT[C/T]
GGGCGATCGTCAGCTCAATAGCCCCTAGACTTGATGGGCCTGAAAGGCTTCTTCGGCCCTCGCGGGGGCGAGCTTGCTTTGGCGAAGTCGTCTCCCTTCG
CGAAGGGAGACGACTTCGCCAAAGCAAGCTCGCCCCCGCGAGGGCCGAAGAAGCCTTTCAGGCCCATCAAGTCTAGGGGCTATTGAGCTGACGATCGCCC[G/A]
ACGGCCCATCAGGGGCCTGTGAACCTCAATTACCCTATGTACCCATGTAAATGTCCCTTTCATAAGGGTAACCATGTAAATTCCCCTGTATAACCAAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.30% | 8.70% | 1.99% | 0.00% | NA |
| All Indica | 2759 | 82.20% | 14.50% | 3.33% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.40% | 5.90% | 6.72% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.10% | 0.22% | 0.00% | NA |
| Indica III | 913 | 71.10% | 27.30% | 1.64% | 0.00% | NA |
| Indica Intermediate | 786 | 81.30% | 14.10% | 4.58% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318766245 | C -> T | LOC_Os03g32780.1 | upstream_gene_variant ; 2847.0bp to feature; MODIFIER | silent_mutation | Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 | N | N | N | N |
| vg0318766245 | C -> T | LOC_Os03g32790.1 | upstream_gene_variant ; 2365.0bp to feature; MODIFIER | silent_mutation | Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 | N | N | N | N |
| vg0318766245 | C -> T | LOC_Os03g32790.2 | upstream_gene_variant ; 2365.0bp to feature; MODIFIER | silent_mutation | Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 | N | N | N | N |
| vg0318766245 | C -> T | LOC_Os03g32790.3 | upstream_gene_variant ; 2365.0bp to feature; MODIFIER | silent_mutation | Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 | N | N | N | N |
| vg0318766245 | C -> T | LOC_Os03g32780-LOC_Os03g32790 | intergenic_region ; MODIFIER | silent_mutation | Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318766245 | NA | 3.24E-08 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 8.25E-06 | mr1912 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 3.25E-07 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 3.73E-07 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 6.87E-06 | mr1185_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 1.20E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 2.98E-06 | mr1269_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 1.23E-06 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | NA | 1.88E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | 8.49E-06 | 5.20E-06 | mr1912_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | 1.64E-06 | 1.64E-06 | mr1912_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318766245 | 2.65E-06 | 2.65E-06 | mr1919_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |