\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318766245:

Variant ID: vg0318766245 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18766245
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTTGGTTATACAGGGGAATTTACATGGTTACCCTTATGAAAGGGACATTTACATGGGTACATAGGGTAATTGAGGTTCACAGGCCCCTGATGGGCCGT[C/T]
GGGCGATCGTCAGCTCAATAGCCCCTAGACTTGATGGGCCTGAAAGGCTTCTTCGGCCCTCGCGGGGGCGAGCTTGCTTTGGCGAAGTCGTCTCCCTTCG

Reverse complement sequence

CGAAGGGAGACGACTTCGCCAAAGCAAGCTCGCCCCCGCGAGGGCCGAAGAAGCCTTTCAGGCCCATCAAGTCTAGGGGCTATTGAGCTGACGATCGCCC[G/A]
ACGGCCCATCAGGGGCCTGTGAACCTCAATTACCCTATGTACCCATGTAAATGTCCCTTTCATAAGGGTAACCATGTAAATTCCCCTGTATAACCAAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 8.70% 1.99% 0.00% NA
All Indica  2759 82.20% 14.50% 3.33% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 87.40% 5.90% 6.72% 0.00% NA
Indica II  465 98.70% 1.10% 0.22% 0.00% NA
Indica III  913 71.10% 27.30% 1.64% 0.00% NA
Indica Intermediate  786 81.30% 14.10% 4.58% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318766245 C -> T LOC_Os03g32780.1 upstream_gene_variant ; 2847.0bp to feature; MODIFIER silent_mutation Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N
vg0318766245 C -> T LOC_Os03g32790.1 upstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N
vg0318766245 C -> T LOC_Os03g32790.2 upstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N
vg0318766245 C -> T LOC_Os03g32790.3 upstream_gene_variant ; 2365.0bp to feature; MODIFIER silent_mutation Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N
vg0318766245 C -> T LOC_Os03g32780-LOC_Os03g32790 intergenic_region ; MODIFIER silent_mutation Average:70.072; most accessible tissue: Minghui63 young leaf, score: 84.144 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318766245 NA 3.24E-08 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 8.25E-06 mr1912 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 3.25E-07 mr1043_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 3.73E-07 mr1043_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 6.87E-06 mr1185_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 1.20E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 2.98E-06 mr1269_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 1.23E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 NA 1.88E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 8.49E-06 5.20E-06 mr1912_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 1.64E-06 1.64E-06 mr1912_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318766245 2.65E-06 2.65E-06 mr1919_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251