\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318764531:

Variant ID: vg0318764531 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18764531
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.75, C: 0.25, others allele: 0.00, population size: 63. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAGGTTCCCGAAGCGTGGTTCGCGGTCATCGCCGAAGGTTCGGAAGGCCGTTATCTCTGAGCAAGGCAAGTCACATCATCCTTGAGCATATTGAATCC[T/C]
AGTTTATAAAATTATTTTGATTTAAATTATTGCATTATCGCTTTATTCAAATTCCCGCGTTATCACTGTTTTATTTAGCCATGCCTATTTATCTTTGTTA

Reverse complement sequence

TAACAAAGATAAATAGGCATGGCTAAATAAAACAGTGATAACGCGGGAATTTGAATAAAGCGATAATGCAATAATTTAAATCAAAATAATTTTATAAACT[A/G]
GGATTCAATATGCTCAAGGATGATGTGACTTGCCTTGCTCAGAGATAACGGCCTTCCGAACCTTCGGCGATGACCGCGAACCACGCTTCGGGAACCTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.10% 35.70% 12.23% 0.02% NA
All Indica  2759 73.00% 8.40% 18.52% 0.04% NA
All Japonica  1512 11.20% 86.30% 2.51% 0.00% NA
Aus  269 82.50% 11.20% 6.32% 0.00% NA
Indica I  595 51.30% 11.40% 37.14% 0.17% NA
Indica II  465 80.60% 6.50% 12.90% 0.00% NA
Indica III  913 81.60% 6.60% 11.83% 0.00% NA
Indica Intermediate  786 74.90% 9.50% 15.52% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 29.60% 66.70% 3.77% 0.00% NA
Japonica Intermediate  241 7.10% 85.10% 7.88% 0.00% NA
VI/Aromatic  96 22.90% 71.90% 5.21% 0.00% NA
Intermediate  90 37.80% 54.40% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318764531 T -> C LOC_Os03g32780.1 upstream_gene_variant ; 1133.0bp to feature; MODIFIER silent_mutation Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg0318764531 T -> C LOC_Os03g32790.1 upstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg0318764531 T -> C LOC_Os03g32790.2 upstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg0318764531 T -> C LOC_Os03g32790.3 upstream_gene_variant ; 4079.0bp to feature; MODIFIER silent_mutation Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg0318764531 T -> C LOC_Os03g32770.1 downstream_gene_variant ; 4089.0bp to feature; MODIFIER silent_mutation Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg0318764531 T -> C LOC_Os03g32780-LOC_Os03g32790 intergenic_region ; MODIFIER silent_mutation Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N
vg0318764531 T -> DEL N N silent_mutation Average:20.885; most accessible tissue: Minghui63 flag leaf, score: 31.47 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318764531 7.75E-06 NA mr1158 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318764531 NA 6.70E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251