Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318756422:

Variant ID: vg0318756422 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18756422
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTCTCCGCCGCGCCCGTTCATCGTTGTTGTTCCCTCGCCTCGTCACGTGGTGGTAAGGATCTCTCTCCCTCATCGCCCTCGTCCTCATCCTTTCGGTGTC[G/A]
CCCGTGCCCGTTGTGCGGTTGTCGGCCCCGGTACCCATGTATTGGTGTCGGTAGTCGTTCGCTTGTGCGTGTGGTGACCGTGTTAGTGTGCCCGCTCGGT

Reverse complement sequence

ACCGAGCGGGCACACTAACACGGTCACCACACGCACAAGCGAACGACTACCGACACCAATACATGGGTACCGGGGCCGACAACCGCACAACGGGCACGGG[C/T]
GACACCGAAAGGATGAGGACGAGGGCGATGAGGGAGAGAGATCCTTACCACCACGTGACGAGGCGAGGGAACAACAACGATGAACGGGCGCGGCGGAGAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.40%	27.00%	0.06%	0.51%	NA
All Indica	2759	68.20%	31.60%	0.11%	0.11%	NA
All Japonica	1512	86.80%	12.00%	0.00%	1.26%	NA
Aus	269	28.30%	71.70%	0.00%	0.00%	NA
Indica I	595	56.60%	43.40%	0.00%	0.00%	NA
Indica II	465	72.90%	26.90%	0.22%	0.00%	NA
Indica III	913	69.00%	31.00%	0.00%	0.00%	NA
Indica Intermediate	786	73.30%	26.10%	0.25%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	67.30%	32.50%	0.00%	0.20%	NA
Japonica Intermediate	241	85.50%	7.10%	0.00%	7.47%	NA
VI/Aromatic	96	77.10%	20.80%	0.00%	2.08%	NA
Intermediate	90	85.60%	14.40%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318756422	G -> A	LOC_Os03g32749.1	upstream_gene_variant ; 569.0bp to feature; MODIFIER	silent_mutation	Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0318756422	G -> A	LOC_Os03g32770.1	upstream_gene_variant ; 1237.0bp to feature; MODIFIER	silent_mutation	Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0318756422	G -> A	LOC_Os03g32749-LOC_Os03g32770	intergenic_region ; MODIFIER	silent_mutation	Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg0318756422	G -> DEL	N	N	silent_mutation	Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318756422	NA	2.64E-06	mr1097	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	3.38E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	2.49E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	6.81E-09	mr1215	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	7.08E-06	mr1215	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	1.48E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	2.82E-06	mr1434	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	1.36E-06	2.94E-12	mr1439	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	3.60E-07	mr1439	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	7.07E-06	7.06E-06	mr1494	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	2.64E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	4.07E-09	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	6.93E-06	mr1735	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	2.41E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	4.09E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	7.10E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	3.73E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	7.54E-07	mr1960	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422	NA	1.76E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251