\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318756422:

Variant ID: vg0318756422 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18756422
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCTCCGCCGCGCCCGTTCATCGTTGTTGTTCCCTCGCCTCGTCACGTGGTGGTAAGGATCTCTCTCCCTCATCGCCCTCGTCCTCATCCTTTCGGTGTC[G/A]
CCCGTGCCCGTTGTGCGGTTGTCGGCCCCGGTACCCATGTATTGGTGTCGGTAGTCGTTCGCTTGTGCGTGTGGTGACCGTGTTAGTGTGCCCGCTCGGT

Reverse complement sequence

ACCGAGCGGGCACACTAACACGGTCACCACACGCACAAGCGAACGACTACCGACACCAATACATGGGTACCGGGGCCGACAACCGCACAACGGGCACGGG[C/T]
GACACCGAAAGGATGAGGACGAGGGCGATGAGGGAGAGAGATCCTTACCACCACGTGACGAGGCGAGGGAACAACAACGATGAACGGGCGCGGCGGAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.40% 27.00% 0.06% 0.51% NA
All Indica  2759 68.20% 31.60% 0.11% 0.11% NA
All Japonica  1512 86.80% 12.00% 0.00% 1.26% NA
Aus  269 28.30% 71.70% 0.00% 0.00% NA
Indica I  595 56.60% 43.40% 0.00% 0.00% NA
Indica II  465 72.90% 26.90% 0.22% 0.00% NA
Indica III  913 69.00% 31.00% 0.00% 0.00% NA
Indica Intermediate  786 73.30% 26.10% 0.25% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 67.30% 32.50% 0.00% 0.20% NA
Japonica Intermediate  241 85.50% 7.10% 0.00% 7.47% NA
VI/Aromatic  96 77.10% 20.80% 0.00% 2.08% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318756422 G -> A LOC_Os03g32749.1 upstream_gene_variant ; 569.0bp to feature; MODIFIER silent_mutation Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0318756422 G -> A LOC_Os03g32770.1 upstream_gene_variant ; 1237.0bp to feature; MODIFIER silent_mutation Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0318756422 G -> A LOC_Os03g32749-LOC_Os03g32770 intergenic_region ; MODIFIER silent_mutation Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N
vg0318756422 G -> DEL N N silent_mutation Average:39.237; most accessible tissue: Minghui63 panicle, score: 59.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318756422 NA 2.64E-06 mr1097 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 3.38E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 2.49E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 6.81E-09 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 7.08E-06 mr1215 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 1.48E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 2.82E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 1.36E-06 2.94E-12 mr1439 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 3.60E-07 mr1439 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 7.07E-06 7.06E-06 mr1494 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 2.64E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 4.07E-09 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 6.93E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 2.41E-06 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 4.09E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 7.10E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 3.73E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 7.54E-07 mr1960 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318756422 NA 1.76E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251