\
| Variant ID: vg0318738445 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18738445 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AAATACTTTGCTTAAAATTTCATTAAATACTTTGCTTAATTCTATAATTGCTAGATTTTTCTGGGATTTATTTGAGCTAAGGAAGTATTTTTAATAAATG[G/A]
AATTGCATTTCATGAATAATTTAAATTGGAAAAGGTTTTAAATTTTCTCTTTTGGCTTTGGGCCGAAAGTCGGCCCAAAACCTTCCCTCTCTCTCTCCTC
GAGGAGAGAGAGAGGGAAGGTTTTGGGCCGACTTTCGGCCCAAAGCCAAAAGAGAAAATTTAAAACCTTTTCCAATTTAAATTATTCATGAAATGCAATT[C/T]
CATTTATTAAAAATACTTCCTTAGCTCAAATAAATCCCAGAAAAATCTAGCAATTATAGAATTAAGCAAAGTATTTAATGAAATTTTAAGCAAAGTATTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.50% | 31.70% | 0.23% | 0.59% | NA |
| All Indica | 2759 | 97.20% | 2.30% | 0.33% | 0.11% | NA |
| All Japonica | 1512 | 12.80% | 85.70% | 0.00% | 1.46% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.30% | 1.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 96.60% | 3.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 3.80% | 0.38% | 0.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 34.30% | 65.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.90% | 83.40% | 0.00% | 8.71% | NA |
| VI/Aromatic | 96 | 22.90% | 74.00% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 52.20% | 45.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318738445 | G -> A | LOC_Os03g32700.1 | downstream_gene_variant ; 840.0bp to feature; MODIFIER | silent_mutation | Average:33.161; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0318738445 | G -> A | LOC_Os03g32700-LOC_Os03g32720 | intergenic_region ; MODIFIER | silent_mutation | Average:33.161; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| vg0318738445 | G -> DEL | N | N | silent_mutation | Average:33.161; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318738445 | NA | 2.53E-07 | mr1162 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318738445 | NA | 1.95E-20 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318738445 | NA | 2.42E-07 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318738445 | 2.46E-06 | 2.20E-10 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318738445 | 1.70E-06 | 1.70E-06 | mr1834 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318738445 | 9.13E-06 | NA | mr1973 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |