\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318738445:

Variant ID: vg0318738445 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18738445
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATACTTTGCTTAAAATTTCATTAAATACTTTGCTTAATTCTATAATTGCTAGATTTTTCTGGGATTTATTTGAGCTAAGGAAGTATTTTTAATAAATG[G/A]
AATTGCATTTCATGAATAATTTAAATTGGAAAAGGTTTTAAATTTTCTCTTTTGGCTTTGGGCCGAAAGTCGGCCCAAAACCTTCCCTCTCTCTCTCCTC

Reverse complement sequence

GAGGAGAGAGAGAGGGAAGGTTTTGGGCCGACTTTCGGCCCAAAGCCAAAAGAGAAAATTTAAAACCTTTTCCAATTTAAATTATTCATGAAATGCAATT[C/T]
CATTTATTAAAAATACTTCCTTAGCTCAAATAAATCCCAGAAAAATCTAGCAATTATAGAATTAAGCAAAGTATTTAATGAAATTTTAAGCAAAGTATTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.50% 31.70% 0.23% 0.59% NA
All Indica  2759 97.20% 2.30% 0.33% 0.11% NA
All Japonica  1512 12.80% 85.70% 0.00% 1.46% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 98.30% 1.00% 0.67% 0.00% NA
Indica II  465 96.60% 3.00% 0.43% 0.00% NA
Indica III  913 98.50% 1.50% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 3.80% 0.38% 0.38% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 34.30% 65.50% 0.00% 0.20% NA
Japonica Intermediate  241 7.90% 83.40% 0.00% 8.71% NA
VI/Aromatic  96 22.90% 74.00% 0.00% 3.12% NA
Intermediate  90 52.20% 45.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318738445 G -> A LOC_Os03g32700.1 downstream_gene_variant ; 840.0bp to feature; MODIFIER silent_mutation Average:33.161; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0318738445 G -> A LOC_Os03g32700-LOC_Os03g32720 intergenic_region ; MODIFIER silent_mutation Average:33.161; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N
vg0318738445 G -> DEL N N silent_mutation Average:33.161; most accessible tissue: Zhenshan97 flag leaf, score: 49.845 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318738445 NA 2.53E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318738445 NA 1.95E-20 mr1588 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318738445 NA 2.42E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318738445 2.46E-06 2.20E-10 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318738445 1.70E-06 1.70E-06 mr1834 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318738445 9.13E-06 NA mr1973 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251