\
| Variant ID: vg0318566007 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18566007 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )
ATTATCTAAACACCACGTCTAAGCAATTAATATCTACTTTAGTGTTTATAACTCACCAAAGCAATCACTATATTTTAGTTGATTATAGTGAACAATAATC[C/T]
CGTATGTTATTTAGGAACTAACTAAGAGATAATTCTCACAAGATAAATCTAAATTACTCAAGAAGAATATTATATTGAATTCAGAGTAATAAACAGAATA
TATTCTGTTTATTACTCTGAATTCAATATAATATTCTTCTTGAGTAATTTAGATTTATCTTGTGAGAATTATCTCTTAGTTAGTTCCTAAATAACATACG[G/A]
GATTATTGTTCACTATAATCAACTAAAATATAGTGATTGCTTTGGTGAGTTATAAACACTAAAGTAGATATTAATTGCTTAGACGTGGTGTTTAGATAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.40% | 15.40% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 80.60% | 19.20% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 87.20% | 12.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 76.80% | 23.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 70.40% | 29.40% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.50% | 15.40% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 64.70% | 35.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318566007 | C -> T | LOC_Os03g32460.1 | upstream_gene_variant ; 4201.0bp to feature; MODIFIER | silent_mutation | Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0318566007 | C -> T | LOC_Os03g32470.1 | upstream_gene_variant ; 4644.0bp to feature; MODIFIER | silent_mutation | Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0318566007 | C -> T | LOC_Os03g32470.2 | upstream_gene_variant ; 4644.0bp to feature; MODIFIER | silent_mutation | Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0318566007 | C -> T | LOC_Os03g32460-LOC_Os03g32470 | intergenic_region ; MODIFIER | silent_mutation | Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318566007 | NA | 1.71E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318566007 | NA | 4.81E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318566007 | NA | 1.57E-08 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318566007 | NA | 4.16E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318566007 | NA | 2.04E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318566007 | 2.43E-07 | 6.37E-08 | mr1439_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318566007 | NA | 3.96E-06 | mr1786_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |