\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318566007:

Variant ID: vg0318566007 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18566007
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


ATTATCTAAACACCACGTCTAAGCAATTAATATCTACTTTAGTGTTTATAACTCACCAAAGCAATCACTATATTTTAGTTGATTATAGTGAACAATAATC[C/T]
CGTATGTTATTTAGGAACTAACTAAGAGATAATTCTCACAAGATAAATCTAAATTACTCAAGAAGAATATTATATTGAATTCAGAGTAATAAACAGAATA

Reverse complement sequence

TATTCTGTTTATTACTCTGAATTCAATATAATATTCTTCTTGAGTAATTTAGATTTATCTTGTGAGAATTATCTCTTAGTTAGTTCCTAAATAACATACG[G/A]
GATTATTGTTCACTATAATCAACTAAAATATAGTGATTGCTTTGGTGAGTTATAAACACTAAAGTAGATATTAATTGCTTAGACGTGGTGTTTAGATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.40% 0.11% 0.00% NA
All Indica  2759 80.60% 19.20% 0.14% 0.00% NA
All Japonica  1512 87.20% 12.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 94.30% 5.70% 0.00% 0.00% NA
Indica II  465 76.80% 23.00% 0.22% 0.00% NA
Indica III  913 70.40% 29.40% 0.22% 0.00% NA
Indica Intermediate  786 84.50% 15.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 64.70% 35.30% 0.00% 0.00% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318566007 C -> T LOC_Os03g32460.1 upstream_gene_variant ; 4201.0bp to feature; MODIFIER silent_mutation Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0318566007 C -> T LOC_Os03g32470.1 upstream_gene_variant ; 4644.0bp to feature; MODIFIER silent_mutation Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0318566007 C -> T LOC_Os03g32470.2 upstream_gene_variant ; 4644.0bp to feature; MODIFIER silent_mutation Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N
vg0318566007 C -> T LOC_Os03g32460-LOC_Os03g32470 intergenic_region ; MODIFIER silent_mutation Average:43.781; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318566007 NA 1.71E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007 NA 4.81E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007 NA 1.57E-08 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007 NA 4.16E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007 NA 2.04E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007 2.43E-07 6.37E-08 mr1439_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318566007 NA 3.96E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251