| Variant ID: vg0318542792 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18542792 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATAGGTTATGAACCTTGAGAACAAATGTGTGCCTTATCTTGTTTAGCGATGTTCGATCACTATAATACTCCCTCCGTTTCGAAATATTTGACACCGTTGA[C/T]
TTTTTAGCATATGTTTGACCGTTCGTCTTATTCGAAAAATTTTGTGAAATATGTAAAATTATATGCCTACATAAAAATATATTTAACAATGAATCAAATG
CATTTGATTCATTGTTAAATATATTTTTATGTAGGCATATAATTTTACATATTTCACAAAATTTTTCGAATAAGACGAACGGTCAAACATATGCTAAAAA[G/A]
TCAACGGTGTCAAATATTTCGAAACGGAGGGAGTATTATAGTGATCGAACATCGCTAAACAAGATAAGGCACACATTTGTTCTCAAGGTTCATAACCTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.20% | 33.60% | 5.46% | 5.69% | NA |
| All Indica | 2759 | 75.30% | 5.90% | 9.13% | 9.68% | NA |
| All Japonica | 1512 | 14.70% | 85.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 89.60% | 9.70% | 0.37% | 0.37% | NA |
| Indica I | 595 | 83.20% | 3.20% | 12.44% | 1.18% | NA |
| Indica II | 465 | 79.40% | 5.20% | 9.68% | 5.81% | NA |
| Indica III | 913 | 70.00% | 5.50% | 5.81% | 18.73% | NA |
| Indica Intermediate | 786 | 73.00% | 8.90% | 10.18% | 7.89% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.90% | 60.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 48.90% | 44.40% | 5.56% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318542792 | C -> T | LOC_Os03g32430.1 | upstream_gene_variant ; 1441.0bp to feature; MODIFIER | silent_mutation | Average:45.2; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0318542792 | C -> T | LOC_Os03g32420.1 | downstream_gene_variant ; 2697.0bp to feature; MODIFIER | silent_mutation | Average:45.2; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0318542792 | C -> T | LOC_Os03g32420-LOC_Os03g32430 | intergenic_region ; MODIFIER | silent_mutation | Average:45.2; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg0318542792 | C -> DEL | N | N | silent_mutation | Average:45.2; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318542792 | NA | 4.39E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318542792 | NA | 1.27E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318542792 | NA | 3.95E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318542792 | 2.35E-06 | 4.89E-15 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318542792 | NA | 4.37E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318542792 | 1.40E-06 | 1.40E-06 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318542792 | NA | 9.55E-07 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318542792 | NA | 2.30E-17 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |