| Variant ID: vg0318534639 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18534639 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 268. )
GAGTCGGCTTGGGGATAAGATGATGTCCGTGATGGTCAGATATCATGCGGGATACTTAGGCTAAAGTTCAATGCACGTGGTTGGTGAAGATTCCATATGG[T/C]
ATACGATGGAGGTATTGTGTGCGTGTGGGATGCGGAGTCGAATTTGGAAGGAGTCCAAATTTGGTATGATTGGAGTTTGTAAAATTTGTTTCTTGTACAA
TTGTACAAGAAACAAATTTTACAAACTCCAATCATACCAAATTTGGACTCCTTCCAAATTCGACTCCGCATCCCACACGCACACAATACCTCCATCGTAT[A/G]
CCATATGGAATCTTCACCAACCACGTGCATTGAACTTTAGCCTAAGTATCCCGCATGATATCTGACCATCACGGACATCATCTTATCCCCAAGCCGACTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.60% | 0.13% | 0.17% | NA |
| All Indica | 2759 | 97.80% | 2.00% | 0.07% | 0.14% | NA |
| All Japonica | 1512 | 16.10% | 83.60% | 0.13% | 0.13% | NA |
| Aus | 269 | 91.40% | 8.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.70% | 0.80% | 0.17% | 0.34% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.10% | 3.60% | 0.13% | 0.25% | NA |
| Temperate Japonica | 767 | 0.30% | 99.60% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 39.90% | 59.70% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 17.00% | 82.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 40.00% | 2.22% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318534639 | T -> C | LOC_Os03g32410.1 | upstream_gene_variant ; 719.0bp to feature; MODIFIER | silent_mutation | Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0318534639 | T -> C | LOC_Os03g32420.1 | upstream_gene_variant ; 4176.0bp to feature; MODIFIER | silent_mutation | Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0318534639 | T -> C | LOC_Os03g32400.1 | downstream_gene_variant ; 3178.0bp to feature; MODIFIER | silent_mutation | Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0318534639 | T -> C | LOC_Os03g32400-LOC_Os03g32410 | intergenic_region ; MODIFIER | silent_mutation | Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| vg0318534639 | T -> DEL | N | N | silent_mutation | Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318534639 | NA | 1.71E-07 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 1.25E-07 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 3.64E-21 | mr1588 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 3.79E-06 | mr1588 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 1.08E-08 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 1.55E-11 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 4.81E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 4.16E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 9.14E-13 | mr1853 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318534639 | NA | 2.04E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/