Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318534639:

Variant ID: vg0318534639 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18534639
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.02, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

GAGTCGGCTTGGGGATAAGATGATGTCCGTGATGGTCAGATATCATGCGGGATACTTAGGCTAAAGTTCAATGCACGTGGTTGGTGAAGATTCCATATGG[T/C]
ATACGATGGAGGTATTGTGTGCGTGTGGGATGCGGAGTCGAATTTGGAAGGAGTCCAAATTTGGTATGATTGGAGTTTGTAAAATTTGTTTCTTGTACAA

Reverse complement sequence

TTGTACAAGAAACAAATTTTACAAACTCCAATCATACCAAATTTGGACTCCTTCCAAATTCGACTCCGCATCCCACACGCACACAATACCTCCATCGTAT[A/G]
CCATATGGAATCTTCACCAACCACGTGCATTGAACTTTAGCCTAAGTATCCCGCATGATATCTGACCATCACGGACATCATCTTATCCCCAAGCCGACTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.10%	30.60%	0.13%	0.17%	NA
All Indica	2759	97.80%	2.00%	0.07%	0.14%	NA
All Japonica	1512	16.10%	83.60%	0.13%	0.13%	NA
Aus	269	91.40%	8.60%	0.00%	0.00%	NA
Indica I	595	98.70%	0.80%	0.17%	0.34%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.90%	1.10%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.60%	0.13%	0.25%	NA
Temperate Japonica	767	0.30%	99.60%	0.00%	0.13%	NA
Tropical Japonica	504	39.90%	59.70%	0.20%	0.20%	NA
Japonica Intermediate	241	17.00%	82.60%	0.41%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	55.60%	40.00%	2.22%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318534639	T -> C	LOC_Os03g32410.1	upstream_gene_variant ; 719.0bp to feature; MODIFIER	silent_mutation	Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0318534639	T -> C	LOC_Os03g32420.1	upstream_gene_variant ; 4176.0bp to feature; MODIFIER	silent_mutation	Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0318534639	T -> C	LOC_Os03g32400.1	downstream_gene_variant ; 3178.0bp to feature; MODIFIER	silent_mutation	Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0318534639	T -> C	LOC_Os03g32400-LOC_Os03g32410	intergenic_region ; MODIFIER	silent_mutation	Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0318534639	T -> DEL	N	N	silent_mutation	Average:44.603; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318534639	NA	1.71E-07	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	1.25E-07	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	3.64E-21	mr1588	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	3.79E-06	mr1588	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	1.08E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	1.55E-11	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	4.81E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	4.16E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	9.14E-13	mr1853	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	2.04E-06	mr1188_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	5.80E-28	mr1588_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	2.27E-08	8.56E-11	mr1588_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	2.41E-07	1.13E-14	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	4.02E-18	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318534639	NA	1.35E-13	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251