Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318510912:

Variant ID: vg0318510912 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18510912
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCTGGTGGTGGGCTACCCCAACGCGCCAGAGTACACGACTGTTCCACCGCTTAGTGGCGAGCTTCCTCACCGTGTCCGCCTGGAGGTCCATGGCTATGT[G/A]
GGCACCTGCCTCGCTAACATGGTGGTTGAGGCGTCCGGAGGCACAGCAGATCACGCCTGTTAGGAGGCAGCATACCTGATGATGGCCAGACTACGGGAGC

Reverse complement sequence

GCTCCCGTAGTCTGGCCATCATCAGGTATGCTGCCTCCTAACAGGCGTGATCTGCTGTGCCTCCGGACGCCTCAACCACCATGTTAGCGAGGCAGGTGCC[C/T]
ACATAGCCATGGACCTCCAGGCGGACACGGTGAGGAAGCTCGCCACTAAGCGGTGGAACAGTCGTGTACTCTGGCGCGTTGGGGTAGCCCACCACCAGCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	4.70%	19.02%	23.95%	NA
All Indica	2759	28.20%	7.90%	30.23%	33.64%	NA
All Japonica	1512	86.20%	0.30%	2.84%	10.58%	NA
Aus	269	89.60%	0.00%	2.23%	8.18%	NA
Indica I	595	22.90%	4.90%	33.28%	38.99%	NA
Indica II	465	21.50%	4.50%	28.17%	45.81%	NA
Indica III	913	36.00%	13.30%	30.23%	20.48%	NA
Indica Intermediate	786	27.20%	6.00%	29.13%	37.66%	NA
Temperate Japonica	767	99.70%	0.00%	0.00%	0.26%	NA
Tropical Japonica	504	66.50%	0.80%	4.56%	28.17%	NA
Japonica Intermediate	241	84.60%	0.40%	8.30%	6.64%	NA
VI/Aromatic	96	94.80%	0.00%	4.17%	1.04%	NA
Intermediate	90	62.20%	1.10%	13.33%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318510912	G -> A	LOC_Os03g32360.1	upstream_gene_variant ; 1260.0bp to feature; MODIFIER	silent_mutation	Average:12.218; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N
vg0318510912	G -> A	LOC_Os03g32350.1	intron_variant ; MODIFIER	silent_mutation	Average:12.218; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N
vg0318510912	G -> DEL	N	N	silent_mutation	Average:12.218; most accessible tissue: Minghui63 young leaf, score: 31.294	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318510912	5.75E-06	4.54E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318510912	NA	4.30E-06	mr1704	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318510912	8.60E-06	NA	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318510912	3.25E-06	3.25E-06	mr1722	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251