\
| Variant ID: vg0318243134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18243134 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 354. )
TGTCCGAATGATTGTATCCTATATCGCGGTGAGGAGTACGAGAACCTAGAAGCATGCCCTGTTTGTAAAGCACTACGATACAAGATTAGACGAGACGATC[C/T]
AGGAGAAGTTGATGGGCAGCTAACAAAGAAGAGAATTCCTGCTAAGGTGATGTGGTATTTCCCTATAATACCACGGCTAAGGCGTTTGTTCAGGAACAAG
CTTGTTCCTGAACAAACGCCTTAGCCGTGGTATTATAGGGAAATACCACATCACCTTAGCAGGAATTCTCTTCTTTGTTAGCTGCCCATCAACTTCTCCT[G/A]
GATCGTCTCGTCTAATCTTGTATCGTAGTGCTTTACAAACAGGGCATGCTTCTAGGTTCTCGTACTCCTCACCGCGATATAGGATACAATCATTCGGACA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.50% | 9.10% | 1.40% | 0.00% | NA |
| All Indica | 2759 | 82.60% | 15.20% | 2.25% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 88.60% | 6.90% | 4.54% | 0.00% | NA |
| Indica II | 465 | 97.60% | 1.30% | 1.08% | 0.00% | NA |
| Indica III | 913 | 71.70% | 28.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 81.80% | 14.60% | 3.56% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 5.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318243134 | C -> T | LOC_Os03g31890.1 | missense_variant ; p.Pro164Leu; MODERATE | nonsynonymous_codon ; P164L | Average:22.038; most accessible tissue: Minghui63 panicle, score: 34.226 | benign |
0.584 |
DELETERIOUS | 0.03 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318243134 | NA | 1.23E-07 | mr1221 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | NA | 2.01E-09 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | NA | 9.89E-07 | mr1043_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | NA | 3.03E-06 | mr1043_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | NA | 4.90E-06 | mr1269_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | NA | 7.81E-06 | mr1502_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | NA | 2.51E-06 | mr1677_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | 4.81E-06 | 2.19E-06 | mr1912_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318243134 | 1.87E-06 | 1.87E-06 | mr1912_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |