Search for Variation information by Variation ID:
Detailed information for vg0318242759:
| Variant ID: vg0318242759 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18242759 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
GGATTTGAAGGAAATCAAACGGGCGAGGAGGAAAGGGATGCTGATGGTAACGACATTGCGGATGATCTTGGTTAGATGTTGCAGGATGCTAAGGAGGACT[G/A]
CGAAAGTGAAAAGGGGGCCTATAAATTGGACAAGATGTTAGAGGACCACAGAATGTCGTTGTACCCAGGTTGCGAGCAGGGGCACAAAAAGTTAGATACA
Reverse complement sequence
TGTATCTAACTTTTTGTGCCCCTGCTCGCAACCTGGGTACAACGACATTCTGTGGTCCTCTAACATCTTGTCCAATTTATAGGCCCCCTTTTCACTTTCG[C/T]
AGTCCTCCTTAGCATCCTGCAACATCTAACCAAGATCATCCGCAATGTCGTTACCATCAGCATCCCTTTCCTCCTCGCCCGTTTGATTTCCTTCAAATCC
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.70% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 97.40% | 2.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.50% | 60.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 47.80% | 1.11% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318242759 | G -> A | LOC_Os03g31890.1 | missense_variant ; p.Cys39Tyr; MODERATE | nonsynonymous_codon ; C39Y | Average:33.009; most accessible tissue: Minghui63 young leaf, score: 47.146 | benign  |
0.713 |
DELETERIOUS | 0.02 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318242759 | 8.51E-07 | 3.92E-11 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | 2.81E-07 | 1.03E-15 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | NA | 3.55E-08 | mr1827 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | NA | 2.41E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | 2.14E-06 | 2.14E-06 | mr1987 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | NA | 7.59E-14 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | NA | 7.77E-17 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | NA | 3.72E-14 | mr1790_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | NA | 9.83E-15 | mr1827_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318242759 | NA | 1.54E-11 | mr1893_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |