Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318242446:

Variant ID: vg0318242446 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18242446
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATTTTTTTTCATCTCATGTAGATGGATCGGCAATGGATGTACGCTAACCGGCGGTCCAAAGAGTTTATTGACGGCGTGCATTATTTTTTGAGAGTGGCC[A/G]
AAGCTAACAGGCATAAGGGTTTTATTTGTTATCCATGCAATAAGTGTAAGAATCATAAGGAGTATTCTGCATCCAGGACTATTCATTTCCACTTGTTTGA

Reverse complement sequence

TCAAACAAGTGGAAATGAATAGTCCTGGATGCAGAATACTCCTTATGATTCTTACACTTATTGCATGGATAACAAATAAAACCCTTATGCCTGTTAGCTT[T/C]
GGCCACTCTCAAAAAATAATGCACGCCGTCAATAAACTCTTTGGACCGCCGGTTAGCGTACATCCATTGCCGATCCATCTACATGAGATGAAAAAAAATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.20%	31.40%	4.42%	0.00%	NA
All Indica	2759	95.90%	2.90%	1.16%	0.00%	NA
All Japonica	1512	16.00%	83.90%	0.07%	0.00%	NA
Aus	269	33.50%	8.60%	57.99%	0.00%	NA
Indica I	595	97.80%	1.50%	0.67%	0.00%	NA
Indica II	465	95.30%	4.50%	0.22%	0.00%	NA
Indica III	913	97.70%	1.30%	0.99%	0.00%	NA
Indica Intermediate	786	92.90%	4.80%	2.29%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	39.70%	60.30%	0.00%	0.00%	NA
Japonica Intermediate	241	16.60%	83.00%	0.41%	0.00%	NA
VI/Aromatic	96	13.50%	72.90%	13.54%	0.00%	NA
Intermediate	90	47.80%	44.40%	7.78%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318242446	A -> G	LOC_Os03g31880.1	upstream_gene_variant ; 1716.0bp to feature; MODIFIER	silent_mutation	Average:27.889; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0318242446	A -> G	LOC_Os03g31890.1	upstream_gene_variant ; 169.0bp to feature; MODIFIER	silent_mutation	Average:27.889; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N
vg0318242446	A -> G	LOC_Os03g31880-LOC_Os03g31890	intergenic_region ; MODIFIER	silent_mutation	Average:27.889; most accessible tissue: Minghui63 flag leaf, score: 43.614	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318242446	NA	1.29E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	7.64E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	5.26E-06	mr1334	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	1.22E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	1.61E-12	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	6.19E-10	mr1827	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	2.09E-06	2.09E-06	mr1827	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	6.09E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	2.35E-23	mr1077_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	3.48E-08	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	1.11E-10	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	4.21E-16	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	1.64E-13	mr1827_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446	NA	4.32E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251