\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318242446:

Variant ID: vg0318242446 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18242446
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTTTTTTCATCTCATGTAGATGGATCGGCAATGGATGTACGCTAACCGGCGGTCCAAAGAGTTTATTGACGGCGTGCATTATTTTTTGAGAGTGGCC[A/G]
AAGCTAACAGGCATAAGGGTTTTATTTGTTATCCATGCAATAAGTGTAAGAATCATAAGGAGTATTCTGCATCCAGGACTATTCATTTCCACTTGTTTGA

Reverse complement sequence

TCAAACAAGTGGAAATGAATAGTCCTGGATGCAGAATACTCCTTATGATTCTTACACTTATTGCATGGATAACAAATAAAACCCTTATGCCTGTTAGCTT[T/C]
GGCCACTCTCAAAAAATAATGCACGCCGTCAATAAACTCTTTGGACCGCCGGTTAGCGTACATCCATTGCCGATCCATCTACATGAGATGAAAAAAAATC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.20% 31.40% 4.42% 0.00% NA
All Indica  2759 95.90% 2.90% 1.16% 0.00% NA
All Japonica  1512 16.00% 83.90% 0.07% 0.00% NA
Aus  269 33.50% 8.60% 57.99% 0.00% NA
Indica I  595 97.80% 1.50% 0.67% 0.00% NA
Indica II  465 95.30% 4.50% 0.22% 0.00% NA
Indica III  913 97.70% 1.30% 0.99% 0.00% NA
Indica Intermediate  786 92.90% 4.80% 2.29% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 39.70% 60.30% 0.00% 0.00% NA
Japonica Intermediate  241 16.60% 83.00% 0.41% 0.00% NA
VI/Aromatic  96 13.50% 72.90% 13.54% 0.00% NA
Intermediate  90 47.80% 44.40% 7.78% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318242446 A -> G LOC_Os03g31880.1 upstream_gene_variant ; 1716.0bp to feature; MODIFIER silent_mutation Average:27.889; most accessible tissue: Minghui63 flag leaf, score: 43.614 N N N N
vg0318242446 A -> G LOC_Os03g31890.1 upstream_gene_variant ; 169.0bp to feature; MODIFIER silent_mutation Average:27.889; most accessible tissue: Minghui63 flag leaf, score: 43.614 N N N N
vg0318242446 A -> G LOC_Os03g31880-LOC_Os03g31890 intergenic_region ; MODIFIER silent_mutation Average:27.889; most accessible tissue: Minghui63 flag leaf, score: 43.614 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318242446 NA 1.29E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 7.64E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 5.26E-06 mr1334 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 1.22E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 1.61E-12 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 6.19E-10 mr1827 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 2.09E-06 2.09E-06 mr1827 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 6.09E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 2.35E-23 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 3.48E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 1.11E-10 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 4.21E-16 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 1.64E-13 mr1827_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318242446 NA 4.32E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251