\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318241664:

Variant ID: vg0318241664 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18241664
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATAAAAACCAGGGCTAAAGATGATCTTTAGTCCCGGTTAAAAAGGGTAACGGCCATATTTGATCTTTAGTCCCGGTTGGTAAGATCATCTTTAGTCC[T/C]
GGTTCAAATGCTGTCAGGGCTTGTCAGGCCCCCCTGGGATCTTTAGTCCCGGTTGGTTACGCTGAGACTAAAGATCCCGGGGATCTTTAGCCCCGGTTCA

Reverse complement sequence

TGAACCGGGGCTAAAGATCCCCGGGATCTTTAGTCTCAGCGTAACCAACCGGGACTAAAGATCCCAGGGGGGCCTGACAAGCCCTGACAGCATTTGAACC[A/G]
GGACTAAAGATGATCTTACCAACCGGGACTAAAGATCAAATATGGCCGTTACCCTTTTTAACCGGGACTAAAGATCATCTTTAGCCCTGGTTTTTATTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.10% 38.40% 0.23% 0.25% NA
All Indica  2759 84.20% 15.40% 0.22% 0.18% NA
All Japonica  1512 16.10% 83.70% 0.07% 0.20% NA
Aus  269 91.80% 7.80% 0.37% 0.00% NA
Indica I  595 95.60% 4.00% 0.17% 0.17% NA
Indica II  465 88.00% 11.60% 0.22% 0.22% NA
Indica III  913 72.10% 27.70% 0.22% 0.00% NA
Indica Intermediate  786 87.50% 11.80% 0.25% 0.38% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 39.70% 59.70% 0.00% 0.60% NA
Japonica Intermediate  241 17.00% 82.60% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 71.90% 0.00% 0.00% NA
Intermediate  90 53.30% 38.90% 3.33% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318241664 T -> C LOC_Os03g31880.1 upstream_gene_variant ; 934.0bp to feature; MODIFIER silent_mutation Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0318241664 T -> C LOC_Os03g31890.1 upstream_gene_variant ; 951.0bp to feature; MODIFIER silent_mutation Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0318241664 T -> C LOC_Os03g31880-LOC_Os03g31890 intergenic_region ; MODIFIER silent_mutation Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 N N N N
vg0318241664 T -> DEL N N silent_mutation Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318241664 NA 3.43E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664 1.77E-07 4.22E-10 mr1718 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664 6.60E-06 2.17E-10 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664 NA 3.39E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664 NA 3.69E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664 NA 6.81E-06 mr1391_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664 NA 1.58E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664 NA 7.91E-12 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251