\
| Variant ID: vg0318241664 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18241664 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 119. )
GCAATAAAAACCAGGGCTAAAGATGATCTTTAGTCCCGGTTAAAAAGGGTAACGGCCATATTTGATCTTTAGTCCCGGTTGGTAAGATCATCTTTAGTCC[T/C]
GGTTCAAATGCTGTCAGGGCTTGTCAGGCCCCCCTGGGATCTTTAGTCCCGGTTGGTTACGCTGAGACTAAAGATCCCGGGGATCTTTAGCCCCGGTTCA
TGAACCGGGGCTAAAGATCCCCGGGATCTTTAGTCTCAGCGTAACCAACCGGGACTAAAGATCCCAGGGGGGCCTGACAAGCCCTGACAGCATTTGAACC[A/G]
GGACTAAAGATGATCTTACCAACCGGGACTAAAGATCAAATATGGCCGTTACCCTTTTTAACCGGGACTAAAGATCATCTTTAGCCCTGGTTTTTATTGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.10% | 38.40% | 0.23% | 0.25% | NA |
| All Indica | 2759 | 84.20% | 15.40% | 0.22% | 0.18% | NA |
| All Japonica | 1512 | 16.10% | 83.70% | 0.07% | 0.20% | NA |
| Aus | 269 | 91.80% | 7.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.60% | 4.00% | 0.17% | 0.17% | NA |
| Indica II | 465 | 88.00% | 11.60% | 0.22% | 0.22% | NA |
| Indica III | 913 | 72.10% | 27.70% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 11.80% | 0.25% | 0.38% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.70% | 59.70% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 17.00% | 82.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 71.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 38.90% | 3.33% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318241664 | T -> C | LOC_Os03g31880.1 | upstream_gene_variant ; 934.0bp to feature; MODIFIER | silent_mutation | Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0318241664 | T -> C | LOC_Os03g31890.1 | upstream_gene_variant ; 951.0bp to feature; MODIFIER | silent_mutation | Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0318241664 | T -> C | LOC_Os03g31880-LOC_Os03g31890 | intergenic_region ; MODIFIER | silent_mutation | Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| vg0318241664 | T -> DEL | N | N | silent_mutation | Average:54.082; most accessible tissue: Minghui63 root, score: 74.812 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318241664 | NA | 3.43E-08 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318241664 | 1.77E-07 | 4.22E-10 | mr1718 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318241664 | 6.60E-06 | 2.17E-10 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318241664 | NA | 3.39E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318241664 | NA | 3.69E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318241664 | NA | 6.81E-06 | mr1391_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318241664 | NA | 1.58E-08 | mr1645_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318241664 | NA | 7.91E-12 | mr1718_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |