Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318241664:

Variant ID: vg0318241664 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18241664
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GCAATAAAAACCAGGGCTAAAGATGATCTTTAGTCCCGGTTAAAAAGGGTAACGGCCATATTTGATCTTTAGTCCCGGTTGGTAAGATCATCTTTAGTCC[T/C]
GGTTCAAATGCTGTCAGGGCTTGTCAGGCCCCCCTGGGATCTTTAGTCCCGGTTGGTTACGCTGAGACTAAAGATCCCGGGGATCTTTAGCCCCGGTTCA

Reverse complement sequence

TGAACCGGGGCTAAAGATCCCCGGGATCTTTAGTCTCAGCGTAACCAACCGGGACTAAAGATCCCAGGGGGGCCTGACAAGCCCTGACAGCATTTGAACC[A/G]
GGACTAAAGATGATCTTACCAACCGGGACTAAAGATCAAATATGGCCGTTACCCTTTTTAACCGGGACTAAAGATCATCTTTAGCCCTGGTTTTTATTGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.10%	38.40%	0.23%	0.25%	NA
All Indica	2759	84.20%	15.40%	0.22%	0.18%	NA
All Japonica	1512	16.10%	83.70%	0.07%	0.20%	NA
Aus	269	91.80%	7.80%	0.37%	0.00%	NA
Indica I	595	95.60%	4.00%	0.17%	0.17%	NA
Indica II	465	88.00%	11.60%	0.22%	0.22%	NA
Indica III	913	72.10%	27.70%	0.22%	0.00%	NA
Indica Intermediate	786	87.50%	11.80%	0.25%	0.38%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	39.70%	59.70%	0.00%	0.60%	NA
Japonica Intermediate	241	17.00%	82.60%	0.41%	0.00%	NA
VI/Aromatic	96	28.10%	71.90%	0.00%	0.00%	NA
Intermediate	90	53.30%	38.90%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318241664	T -> C	LOC_Os03g31880.1	upstream_gene_variant ; 934.0bp to feature; MODIFIER	silent_mutation	Average:54.082; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0318241664	T -> C	LOC_Os03g31890.1	upstream_gene_variant ; 951.0bp to feature; MODIFIER	silent_mutation	Average:54.082; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0318241664	T -> C	LOC_Os03g31880-LOC_Os03g31890	intergenic_region ; MODIFIER	silent_mutation	Average:54.082; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N
vg0318241664	T -> DEL	N	N	silent_mutation	Average:54.082; most accessible tissue: Minghui63 root, score: 74.812	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318241664	NA	3.43E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664	1.77E-07	4.22E-10	mr1718	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664	6.60E-06	2.17E-10	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664	NA	3.39E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664	NA	3.69E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664	NA	6.81E-06	mr1391_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664	NA	1.58E-08	mr1645_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318241664	NA	7.91E-12	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251