Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318165198:

Variant ID: vg0318165198 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18165198
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACAGCGGCCCCTAGTAGAACGTATTGACCCACCGGGCATACATAAAGATCATATCGGCTGAACCTCTAGTGTATACTTGTATGAAGCCATTTGCCTCAC[G/T]
ATATCGATTAAGCTCAAGGCTAGATATGTACCATCCTCTAATAGCTCAATCATTCACTCGAACCTATTGATATCTCTCCATAGGAGGGGCAAATCCCATC

Reverse complement sequence

GATGGGATTTGCCCCTCCTATGGAGAGATATCAATAGGTTCGAGTGAATGATTGAGCTATTAGAGGATGGTACATATCTAGCCTTGAGCTTAATCGATAT[C/A]
GTGAGGCAAATGGCTTCATACAAGTATACACTAGAGGTTCAGCCGATATGATCTTTATGTATGCCCGGTGGGTCAATACGTTCTACTAGGGGCCGCTGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.60%	32.10%	0.23%	0.00%	NA
All Indica	2759	96.70%	3.00%	0.29%	0.00%	NA
All Japonica	1512	14.20%	85.60%	0.20%	0.00%	NA
Aus	269	90.70%	9.30%	0.00%	0.00%	NA
Indica I	595	97.80%	2.00%	0.17%	0.00%	NA
Indica II	465	95.90%	3.40%	0.65%	0.00%	NA
Indica III	913	98.50%	1.20%	0.33%	0.00%	NA
Indica Intermediate	786	94.40%	5.50%	0.13%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	38.30%	61.10%	0.60%	0.00%	NA
Japonica Intermediate	241	7.90%	92.10%	0.00%	0.00%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	51.10%	48.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318165198	G -> T	LOC_Os03g31760.1	downstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:49.664; most accessible tissue: Zhenshan97 flag leaf, score: 71.238	N	N	N	N
vg0318165198	G -> T	LOC_Os03g31750-LOC_Os03g31760	intergenic_region ; MODIFIER	silent_mutation	Average:49.664; most accessible tissue: Zhenshan97 flag leaf, score: 71.238	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318165198	2.33E-09	1.11E-12	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	NA	3.54E-13	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	NA	4.21E-06	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	NA	4.88E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	NA	5.36E-09	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	1.45E-06	5.64E-12	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	7.56E-07	1.08E-20	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	NA	2.05E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318165198	NA	2.74E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251