\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318147668:

Variant ID: vg0318147668 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18147668
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, T: 0.11, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


AGCTGCGAATGTACGATAACTATTTTCAATTTATTTTATTCTTTTGTTGCAACTTGTAAAAGTTGAATTTGGTCTTGTATATTTGTGGAGTGATATATTT[T/C]
ATATTAATCTATGTTGTCGATTTTTTTTATTTTTTTTATAACTATTCAGATGACACGTAATCAACGAGAGGATATCTACATAACCAATTCCATACTAGAT

Reverse complement sequence

ATCTAGTATGGAATTGGTTATGTAGATATCCTCTCGTTGATTACGTGTCATCTGAATAGTTATAAAAAAAATAAAAAAAATCGACAACATAGATTAATAT[A/G]
AAATATATCACTCCACAAATATACAAGACCAAATTCAACTTTTACAAGTTGCAACAAAAGAATAAAATAAATTGAAAATAGTTATCGTACATTCGCAGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.00% 43.90% 0.04% 0.00% NA
All Indica  2759 84.90% 15.00% 0.04% 0.00% NA
All Japonica  1512 15.50% 84.50% 0.00% 0.00% NA
Aus  269 8.60% 91.40% 0.00% 0.00% NA
Indica I  595 58.20% 41.70% 0.17% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 85.50% 14.50% 0.00% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 38.10% 61.90% 0.00% 0.00% NA
Japonica Intermediate  241 16.20% 83.80% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318147668 T -> C LOC_Os03g31740.1 upstream_gene_variant ; 388.0bp to feature; MODIFIER silent_mutation Average:47.842; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0318147668 T -> C LOC_Os03g31730.1 downstream_gene_variant ; 4371.0bp to feature; MODIFIER silent_mutation Average:47.842; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N
vg0318147668 T -> C LOC_Os03g31730-LOC_Os03g31740 intergenic_region ; MODIFIER silent_mutation Average:47.842; most accessible tissue: Zhenshan97 root, score: 59.664 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318147668 NA 1.04E-07 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 9.45E-06 9.45E-06 mr1362 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 3.04E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 7.66E-08 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 1.36E-09 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 4.65E-09 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 1.91E-08 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 8.24E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 1.50E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 7.06E-08 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 2.27E-06 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 2.61E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 3.33E-08 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 5.91E-06 NA mr1828_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 1.23E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 9.99E-11 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318147668 NA 1.09E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251