\
| Variant ID: vg0318126392 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18126392 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 99. )
ATAAACTAGTCTCAAATTTTCAAATTTATTTTTGCATACGGCTTCTTAAGTTACCCGTATGGAAAAATTGATTTTTCCATGTGGGTCCTTAAGTGGTCCA[C/T]
GTACAAACAAATGAAAAAAATTCAATTCTGAAAAATAATCACTCGAATTTTTAAAAACTTTCAATTGAAATGTTCAACCCAAAATTTAAAATATTCAACC
GGTTGAATATTTTAAATTTTGGGTTGAACATTTCAATTGAAAGTTTTTAAAAATTCGAGTGATTATTTTTCAGAATTGAATTTTTTTCATTTGTTTGTAC[G/A]
TGGACCACTTAAGGACCCACATGGAAAAATCAATTTTTCCATACGGGTAACTTAAGAAGCCGTATGCAAAAATAAATTTGAAAATTTGAGACTAGTTTAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.60% | 31.10% | 10.75% | 2.48% | NA |
| All Indica | 2759 | 76.40% | 2.50% | 17.14% | 3.95% | NA |
| All Japonica | 1512 | 14.30% | 84.10% | 1.52% | 0.13% | NA |
| Aus | 269 | 90.30% | 7.10% | 1.49% | 1.12% | NA |
| Indica I | 595 | 83.90% | 2.40% | 8.74% | 5.04% | NA |
| Indica II | 465 | 64.70% | 3.40% | 26.45% | 5.38% | NA |
| Indica III | 913 | 80.00% | 1.20% | 16.10% | 2.74% | NA |
| Indica Intermediate | 786 | 73.70% | 3.40% | 19.21% | 3.69% | NA |
| Temperate Japonica | 767 | 0.10% | 99.70% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 39.10% | 60.30% | 0.40% | 0.20% | NA |
| Japonica Intermediate | 241 | 7.50% | 83.80% | 8.71% | 0.00% | NA |
| VI/Aromatic | 96 | 22.90% | 76.00% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 43.30% | 45.60% | 8.89% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318126392 | C -> T | LOC_Os03g31730.1 | intron_variant ; MODIFIER | silent_mutation | Average:17.541; most accessible tissue: Callus, score: 27.038 | N | N | N | N |
| vg0318126392 | C -> DEL | N | N | silent_mutation | Average:17.541; most accessible tissue: Callus, score: 27.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318126392 | NA | 8.70E-10 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 6.26E-07 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 8.48E-08 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 8.49E-15 | mr1218 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 5.97E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 5.85E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 2.85E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 3.36E-06 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 7.34E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | 4.04E-07 | 1.40E-13 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 7.54E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 6.94E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 8.26E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 1.41E-08 | mr1852 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | 6.56E-08 | 6.55E-08 | mr1987 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 5.83E-09 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 7.06E-16 | mr1750_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 1.83E-08 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318126392 | NA | 7.09E-08 | mr1987_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |