Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318103123:

Variant ID: vg0318103123 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18103123
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TACCACTTGCCAGATCTCAACTGGCTCCCCTTCTATTTGGTGGGGTACTTTTCGTGACTTTGAGTATGATAGTCCCTCTTGCCCTATTTTCACCAGATGT[C/G]
TCCGGTTACTTTAGGGTCATGAGGAGCTGAAGTTTCTTGTCCAATTGTTTTTATTCGAGGCCTCTAGACAAGATGAGGGATACATTTACTTTCTTCGGTA

Reverse complement sequence

TACCGAAGAAAGTAAATGTATCCCTCATCTTGTCTAGAGGCCTCGAATAAAAACAATTGGACAAGAAACTTCAGCTCCTCATGACCCTAAAGTAACCGGA[G/C]
ACATCTGGTGAAAATAGGGCAAGAGGGACTATCATACTCAAAGTCACGAAAAGTACCCCACCAAATAGAAGGGGAGCCAGTTGAGATCTGGCAAGTGGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	43.40%	0.08%	0.00%	NA
All Indica	2759	28.10%	71.80%	0.11%	0.00%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	91.80%	8.20%	0.00%	0.00%	NA
Indica I	595	44.00%	55.80%	0.17%	0.00%	NA
Indica II	465	14.60%	85.40%	0.00%	0.00%	NA
Indica III	913	29.40%	70.60%	0.00%	0.00%	NA
Indica Intermediate	786	22.60%	77.10%	0.25%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	98.60%	1.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	58.90%	40.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318103123	C -> G	LOC_Os03g31700.1	downstream_gene_variant ; 2073.0bp to feature; MODIFIER	silent_mutation	Average:43.228; most accessible tissue: Minghui63 flag leaf, score: 60.569	N	N	N	N
vg0318103123	C -> G	LOC_Os03g31700-LOC_Os03g31706	intergenic_region ; MODIFIER	silent_mutation	Average:43.228; most accessible tissue: Minghui63 flag leaf, score: 60.569	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318103123	NA	2.80E-06	mr1221	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	2.49E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	1.35E-08	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	4.25E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	1.22E-09	mr1221_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	3.84E-07	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	6.00E-07	3.79E-08	mr1391_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	1.00E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	4.81E-09	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	6.04E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	8.17E-08	mr1804_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	7.53E-08	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	1.55E-10	mr1850_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	1.85E-08	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318103123	NA	2.81E-06	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251