Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0318065659:

Variant ID: vg0318065659 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18065659
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:

AGCAAATAGACCATCCAGGTTTTAGATGCACCGGTGTAACCAACAGTCCCTCCTCAACGAACTGGAGTATATCTGTGTCGAAACAAGATTTCGGCAATAC[T/C]
AAAAGGGGGTGGCTATCAAGCTGGAAAAGTGAATGGGTTGAGAGACAAGGAATTTTATACAGGTTCAGGCCTTCTTAATCAAGAAGTAATACCCTACTCC

Reverse complement sequence

GGAGTAGGGTATTACTTCTTGATTAAGAAGGCCTGAACCTGTATAAAATTCCTTGTCTCTCAACCCATTCACTTTTCCAGCTTGATAGCCACCCCCTTTT[A/G]
GTATTGCCGAAATCTTGTTTCGACACAGATATACTCCAGTTCGTTGAGGAGGGACTGTTGGTTACACCGGTGCATCTAAAACCTGGATGGTCTATTTGCT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.80%	6.20%	0.00%	0.00%	NA
All Indica	2759	98.80%	1.20%	0.00%	0.00%	NA
All Japonica	1512	99.40%	0.60%	0.00%	0.00%	NA
Aus	269	15.20%	84.80%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	97.50%	2.50%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	98.40%	1.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318065659	T -> C	LOC_Os03g31640.1	upstream_gene_variant ; 1469.0bp to feature; MODIFIER	silent_mutation	Average:50.213; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0318065659	T -> C	LOC_Os03g31634.1	downstream_gene_variant ; 4430.0bp to feature; MODIFIER	silent_mutation	Average:50.213; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N
vg0318065659	T -> C	LOC_Os03g31634-LOC_Os03g31640	intergenic_region ; MODIFIER	silent_mutation	Average:50.213; most accessible tissue: Minghui63 flag leaf, score: 69.681	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318065659	NA	1.08E-06	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	4.43E-10	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	1.51E-07	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	7.69E-10	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	7.14E-07	mr1735	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	5.75E-07	mr1952	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	2.45E-06	NA	mr1151_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	2.31E-07	NA	mr1248_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	3.40E-20	mr1305_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	2.02E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318065659	NA	3.47E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251