\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318051636:

Variant ID: vg0318051636 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18051636
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


CGCCGGGAGCCGGAGCCGCTGCGAACGTCAACGTCAACGGAGGCAGTTCTGCCTCACAATCCAGCGGAGAGACATTCTCGGGGTATATCTTTCTGCTACT[G/A]
TTAACTCATTCTTTGATACCTCTGTTAGAATTGCGTTCTTGGTATGTTCATGATGCTTATTATACTTTAAGCATGCTCTGGTTATGTTACATTTTATCAT

Reverse complement sequence

ATGATAAAATGTAACATAACCAGAGCATGCTTAAAGTATAATAAGCATCATGAACATACCAAGAACGCAATTCTAACAGAGGTATCAAAGAATGAGTTAA[C/T]
AGTAGCAGAAAGATATACCCCGAGAATGTCTCTCCGCTGGATTGTGAGGCAGAACTGCCTCCGTTGACGTTGACGTTCGCAGCGGCTCCGGCTCCCGGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.10% 49.60% 0.15% 0.17% NA
All Indica  2759 83.10% 16.40% 0.22% 0.22% NA
All Japonica  1512 0.80% 99.10% 0.07% 0.00% NA
Aus  269 8.20% 91.80% 0.00% 0.00% NA
Indica I  595 95.10% 4.20% 0.34% 0.34% NA
Indica II  465 88.20% 11.20% 0.43% 0.22% NA
Indica III  913 70.80% 29.10% 0.11% 0.00% NA
Indica Intermediate  786 85.50% 14.00% 0.13% 0.38% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.40% 0.20% 0.00% NA
Japonica Intermediate  241 0.40% 99.60% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318051636 G -> A LOC_Os03g31630.1 upstream_gene_variant ; 1374.0bp to feature; MODIFIER silent_mutation Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236 N N N N
vg0318051636 G -> A LOC_Os03g31620.1 downstream_gene_variant ; 1326.0bp to feature; MODIFIER silent_mutation Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236 N N N N
vg0318051636 G -> A LOC_Os03g31620-LOC_Os03g31630 intergenic_region ; MODIFIER silent_mutation Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236 N N N N
vg0318051636 G -> DEL N N silent_mutation Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318051636 NA 2.01E-48 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 2.13E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 6.78E-15 mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 3.01E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 3.90E-07 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.37E-09 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.36E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 5.18E-62 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 7.00E-38 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 3.03E-38 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 2.08E-23 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 3.91E-29 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 3.50E-25 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 3.31E-12 mr1377_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 2.96E-07 1.07E-07 mr1391_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 3.64E-07 3.64E-07 mr1391_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.72E-38 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 3.39E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.18E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 4.59E-06 NA mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.40E-07 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 6.83E-08 mr1700_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 8.71E-13 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.45E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 2.81E-50 mr1721_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 2.05E-15 mr1744_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 8.50E-13 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.22E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636 NA 1.01E-15 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251