Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318051636:

Variant ID: vg0318051636 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18051636
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.05, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:

CGCCGGGAGCCGGAGCCGCTGCGAACGTCAACGTCAACGGAGGCAGTTCTGCCTCACAATCCAGCGGAGAGACATTCTCGGGGTATATCTTTCTGCTACT[G/A]
TTAACTCATTCTTTGATACCTCTGTTAGAATTGCGTTCTTGGTATGTTCATGATGCTTATTATACTTTAAGCATGCTCTGGTTATGTTACATTTTATCAT

Reverse complement sequence

ATGATAAAATGTAACATAACCAGAGCATGCTTAAAGTATAATAAGCATCATGAACATACCAAGAACGCAATTCTAACAGAGGTATCAAAGAATGAGTTAA[C/T]
AGTAGCAGAAAGATATACCCCGAGAATGTCTCTCCGCTGGATTGTGAGGCAGAACTGCCTCCGTTGACGTTGACGTTCGCAGCGGCTCCGGCTCCCGGCG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.10%	49.60%	0.15%	0.17%	NA
All Indica	2759	83.10%	16.40%	0.22%	0.22%	NA
All Japonica	1512	0.80%	99.10%	0.07%	0.00%	NA
Aus	269	8.20%	91.80%	0.00%	0.00%	NA
Indica I	595	95.10%	4.20%	0.34%	0.34%	NA
Indica II	465	88.20%	11.20%	0.43%	0.22%	NA
Indica III	913	70.80%	29.10%	0.11%	0.00%	NA
Indica Intermediate	786	85.50%	14.00%	0.13%	0.38%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	1.40%	98.40%	0.20%	0.00%	NA
Japonica Intermediate	241	0.40%	99.60%	0.00%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	42.20%	55.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318051636	G -> A	LOC_Os03g31630.1	upstream_gene_variant ; 1374.0bp to feature; MODIFIER	silent_mutation	Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236	N	N	N	N
vg0318051636	G -> A	LOC_Os03g31620.1	downstream_gene_variant ; 1326.0bp to feature; MODIFIER	silent_mutation	Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236	N	N	N	N
vg0318051636	G -> A	LOC_Os03g31620-LOC_Os03g31630	intergenic_region ; MODIFIER	silent_mutation	Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236	N	N	N	N
vg0318051636	G -> DEL	N	N	silent_mutation	Average:50.361; most accessible tissue: Zhenshan97 flower, score: 67.236	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318051636	NA	2.01E-48	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	2.13E-24	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	6.78E-15	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	3.01E-12	mr1449	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	3.90E-07	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.37E-09	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.36E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	5.18E-62	mr1109_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	7.00E-38	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	3.03E-38	mr1251_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	2.08E-23	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	3.91E-29	mr1270_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	3.50E-25	mr1316_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	3.31E-12	mr1377_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	2.96E-07	1.07E-07	mr1391_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	3.64E-07	3.64E-07	mr1391_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.72E-38	mr1435_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	3.39E-23	mr1551_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.18E-13	mr1552_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	4.59E-06	NA	mr1603_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.40E-07	mr1612_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	6.83E-08	mr1700_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	8.71E-13	mr1718_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.45E-14	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	2.81E-50	mr1721_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	2.05E-15	mr1744_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	8.50E-13	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.22E-07	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318051636	NA	1.01E-15	mr1938_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251