Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318042622:

Variant ID: vg0318042622 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18042622
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

GTAACAAAAAAAAACAAAAAATCTGACAGTTTTAAGGTTGCAATTTTATCAGAATTTTATCTTTTTTGTTATTCTCTATGTAGAATGAATTCGAAGATGC[G/A]
ACTTTGCACGTAGATGTAATACTATTGAAAGTACATGAATGAATTTTCCTAGAATTTTTTGTGATAATTTTTAGTTGGTGTACACGGTGTGTACACCAAC

Reverse complement sequence

GTTGGTGTACACACCGTGTACACCAACTAAAAATTATCACAAAAAATTCTAGGAAAATTCATTCATGTACTTTCAATAGTATTACATCTACGTGCAAAGT[C/T]
GCATCTTCGAATTCATTCTACATAGAGAATAACAAAAAAGATAAAATTCTGATAAAATTGCAACCTTAAAACTGTCAGATTTTTTGTTTTTTTTTGTTAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.20%	17.40%	30.28%	20.14%	NA
All Indica	2759	3.90%	26.30%	36.64%	33.13%	NA
All Japonica	1512	84.40%	1.80%	13.36%	0.46%	NA
Aus	269	8.60%	18.60%	69.89%	2.97%	NA
Indica I	595	2.20%	29.70%	36.97%	31.09%	NA
Indica II	465	4.30%	17.40%	44.30%	33.98%	NA
Indica III	913	3.00%	32.30%	31.76%	32.97%	NA
Indica Intermediate	786	6.10%	22.00%	37.53%	34.35%	NA
Temperate Japonica	767	99.60%	0.10%	0.00%	0.26%	NA
Tropical Japonica	504	60.70%	5.00%	33.33%	0.99%	NA
Japonica Intermediate	241	85.50%	0.40%	14.11%	0.00%	NA
VI/Aromatic	96	77.10%	9.40%	11.46%	2.08%	NA
Intermediate	90	45.60%	10.00%	21.11%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318042622	G -> A	LOC_Os03g31620.1	upstream_gene_variant ; 3395.0bp to feature; MODIFIER	silent_mutation	Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0318042622	G -> A	LOC_Os03g31594.1	downstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0318042622	G -> A	LOC_Os03g31594.2	downstream_gene_variant ; 749.0bp to feature; MODIFIER	silent_mutation	Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0318042622	G -> A	LOC_Os03g31594-LOC_Os03g31620	intergenic_region ; MODIFIER	silent_mutation	Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N
vg0318042622	G -> DEL	N	N	silent_mutation	Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318042622	NA	1.43E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	8.48E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	1.35E-08	mr1275	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	4.17E-06	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	2.05E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	7.89E-09	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	3.88E-13	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	7.54E-07	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	2.96E-19	mr1845	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	6.94E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	1.17E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	1.41E-08	mr1852	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	5.83E-09	mr1136_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	8.28E-11	mr1537_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	2.41E-06	NA	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	4.64E-09	4.02E-14	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	5.02E-19	mr1750_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	3.18E-06	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622	NA	1.83E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251