\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318042622:

Variant ID: vg0318042622 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18042622
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


GTAACAAAAAAAAACAAAAAATCTGACAGTTTTAAGGTTGCAATTTTATCAGAATTTTATCTTTTTTGTTATTCTCTATGTAGAATGAATTCGAAGATGC[G/A]
ACTTTGCACGTAGATGTAATACTATTGAAAGTACATGAATGAATTTTCCTAGAATTTTTTGTGATAATTTTTAGTTGGTGTACACGGTGTGTACACCAAC

Reverse complement sequence

GTTGGTGTACACACCGTGTACACCAACTAAAAATTATCACAAAAAATTCTAGGAAAATTCATTCATGTACTTTCAATAGTATTACATCTACGTGCAAAGT[C/T]
GCATCTTCGAATTCATTCTACATAGAGAATAACAAAAAAGATAAAATTCTGATAAAATTGCAACCTTAAAACTGTCAGATTTTTTGTTTTTTTTTGTTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.20% 17.40% 30.28% 20.14% NA
All Indica  2759 3.90% 26.30% 36.64% 33.13% NA
All Japonica  1512 84.40% 1.80% 13.36% 0.46% NA
Aus  269 8.60% 18.60% 69.89% 2.97% NA
Indica I  595 2.20% 29.70% 36.97% 31.09% NA
Indica II  465 4.30% 17.40% 44.30% 33.98% NA
Indica III  913 3.00% 32.30% 31.76% 32.97% NA
Indica Intermediate  786 6.10% 22.00% 37.53% 34.35% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 60.70% 5.00% 33.33% 0.99% NA
Japonica Intermediate  241 85.50% 0.40% 14.11% 0.00% NA
VI/Aromatic  96 77.10% 9.40% 11.46% 2.08% NA
Intermediate  90 45.60% 10.00% 21.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318042622 G -> A LOC_Os03g31620.1 upstream_gene_variant ; 3395.0bp to feature; MODIFIER silent_mutation Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0318042622 G -> A LOC_Os03g31594.1 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0318042622 G -> A LOC_Os03g31594.2 downstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0318042622 G -> A LOC_Os03g31594-LOC_Os03g31620 intergenic_region ; MODIFIER silent_mutation Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0318042622 G -> DEL N N silent_mutation Average:29.534; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318042622 NA 1.43E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 8.48E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 1.35E-08 mr1275 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 4.17E-06 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 2.05E-06 mr1622 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 7.89E-09 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 3.88E-13 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 7.54E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 2.96E-19 mr1845 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 6.94E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 1.17E-06 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 1.41E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 5.83E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 8.28E-11 mr1537_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 2.41E-06 NA mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 4.64E-09 4.02E-14 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 5.02E-19 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 3.18E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042622 NA 1.83E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251