\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318042099:

Variant ID: vg0318042099 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18042099
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGCACATAGGCCCTCACGTGTACACACGTGCACACCAATTAAAAAATGTCACCAAAAAATCTAGAAAAAATCATACACATACTTTCAATTGTATTACA[C/T]
CTAGGGTTAAAATGTTAACGTCAAATTCATTATATTTTAGCCGTAACAAAAAAACAAAAAATCTGACAGTTTTAAGGTTGCAATTTTGTCAAAATTTTAT

Reverse complement sequence

ATAAAATTTTGACAAAATTGCAACCTTAAAACTGTCAGATTTTTTGTTTTTTTGTTACGGCTAAAATATAATGAATTTGACGTTAACATTTTAACCCTAG[G/A]
TGTAATACAATTGAAAGTATGTGTATGATTTTTTCTAGATTTTTTGGTGACATTTTTTAATTGGTGTGCACGTGTGTACACGTGAGGGCCTATGTGCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.80% 6.20% 0.00% 0.00% NA
All Indica  2759 98.80% 1.20% 0.00% 0.00% NA
All Japonica  1512 99.40% 0.60% 0.00% 0.00% NA
Aus  269 16.00% 84.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 97.50% 2.50% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 98.40% 1.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 78.10% 21.90% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318042099 C -> T LOC_Os03g31620.1 upstream_gene_variant ; 3918.0bp to feature; MODIFIER silent_mutation Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0318042099 C -> T LOC_Os03g31594.1 downstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0318042099 C -> T LOC_Os03g31594.2 downstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N
vg0318042099 C -> T LOC_Os03g31594-LOC_Os03g31620 intergenic_region ; MODIFIER silent_mutation Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318042099 NA 7.45E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 5.80E-06 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 NA 1.58E-07 mr1530 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 NA 2.23E-06 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 1.22E-06 NA mr1243_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 NA 3.62E-21 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 NA 1.19E-11 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 NA 7.50E-06 mr1603_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318042099 NA 2.08E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251