\
| Variant ID: vg0318042099 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18042099 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATGCACATAGGCCCTCACGTGTACACACGTGCACACCAATTAAAAAATGTCACCAAAAAATCTAGAAAAAATCATACACATACTTTCAATTGTATTACA[C/T]
CTAGGGTTAAAATGTTAACGTCAAATTCATTATATTTTAGCCGTAACAAAAAAACAAAAAATCTGACAGTTTTAAGGTTGCAATTTTGTCAAAATTTTAT
ATAAAATTTTGACAAAATTGCAACCTTAAAACTGTCAGATTTTTTGTTTTTTTGTTACGGCTAAAATATAATGAATTTGACGTTAACATTTTAACCCTAG[G/A]
TGTAATACAATTGAAAGTATGTGTATGATTTTTTCTAGATTTTTTGGTGACATTTTTTAATTGGTGTGCACGTGTGTACACGTGAGGGCCTATGTGCATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Aus | 269 | 16.00% | 84.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318042099 | C -> T | LOC_Os03g31620.1 | upstream_gene_variant ; 3918.0bp to feature; MODIFIER | silent_mutation | Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 | N | N | N | N |
| vg0318042099 | C -> T | LOC_Os03g31594.1 | downstream_gene_variant ; 226.0bp to feature; MODIFIER | silent_mutation | Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 | N | N | N | N |
| vg0318042099 | C -> T | LOC_Os03g31594.2 | downstream_gene_variant ; 226.0bp to feature; MODIFIER | silent_mutation | Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 | N | N | N | N |
| vg0318042099 | C -> T | LOC_Os03g31594-LOC_Os03g31620 | intergenic_region ; MODIFIER | silent_mutation | Average:56.279; most accessible tissue: Zhenshan97 root, score: 78.63 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318042099 | NA | 7.45E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | 5.80E-06 | NA | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | NA | 1.58E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | NA | 2.23E-06 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | 1.22E-06 | NA | mr1243_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | NA | 3.62E-21 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | NA | 1.19E-11 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | NA | 7.50E-06 | mr1603_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318042099 | NA | 2.08E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |