\
| Variant ID: vg0318010651 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18010651 |
| Reference Allele: A | Alternative Allele: T,G |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )
CGATGATGATGCTAATGCTACATTTATCCTTTTCGGAAGGATCGCACAACGGCTACTACGCAGGCCCATAGAATCTCTCATTGAAGAAAATCCACCAAAC[A/T,G]
GTGAATACATTCCAAGTGAAATCACGTCACTTATTGGCAGCAATTTTCCATGGAATGTTAGCTTTACACGGGATACTGTTATGAGAAGTCAAGAGTGCCT
AGGCACTCTTGACTTCTCATAACAGTATCCCGTGTAAAGCTAACATTCCATGGAAAATTGCTGCCAATAAGTGACGTGATTTCACTTGGAATGTATTCAC[T/A,C]
GTTTGGTGGATTTTCTTCAATGAGAGATTCTATGGGCCTGCGTAGTAGCCGTTGTGCGATCCTTCCGAAAAGGATAAATGTAGCATTAGCATCATCATCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.00% | 18.30% | 2.69% | 0.00% | G: 0.02% |
| All Indica | 2759 | 98.30% | 1.40% | 0.22% | 0.00% | G: 0.04% |
| All Japonica | 1512 | 44.80% | 47.50% | 7.67% | 0.00% | NA |
| Aus | 269 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.70% | 0.34% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.30% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.00% | 0.00% | G: 0.11% |
| Indica Intermediate | 786 | 97.20% | 2.40% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 48.40% | 40.00% | 11.60% | 0.00% | NA |
| Tropical Japonica | 504 | 46.40% | 51.00% | 2.58% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.30% | 63.90% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 69.80% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 26.70% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318010651 | A -> T | LOC_Os03g31560.1 | missense_variant ; p.Ser1318Cys; MODERATE | nonsynonymous_codon ; S1318Y | Average:44.37; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 | probably damaging |
2.305 |
DELETERIOUS | 0.02 |
| vg0318010651 | A -> T | LOC_Os03g31560.1 | missense_variant ; p.Ser1318Cys; MODERATE | nonsynonymous_codon ; S1318C | Average:44.37; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 | probably damaging |
2.937 |
DELETERIOUS | 0.01 |
| vg0318010651 | A -> G | LOC_Os03g31560.1 | missense_variant ; p.Ser1318Gly; MODERATE | nonsynonymous_codon ; S1318G | Average:44.37; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 | benign |
1.208 |
DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318010651 | NA | 2.53E-11 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 5.98E-11 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 1.94E-06 | mr1215 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 6.56E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 1.62E-12 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 2.59E-07 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 1.12E-10 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 3.22E-07 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 7.57E-07 | mr1060_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | 5.06E-06 | 5.06E-06 | mr1355_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | 4.47E-06 | 4.47E-06 | mr1360_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 4.02E-06 | mr1576_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 9.85E-08 | mr1709_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318010651 | NA | 7.80E-10 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |