\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318010651:

Variant ID: vg0318010651 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18010651
Reference Allele: AAlternative Allele: T,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:


CGATGATGATGCTAATGCTACATTTATCCTTTTCGGAAGGATCGCACAACGGCTACTACGCAGGCCCATAGAATCTCTCATTGAAGAAAATCCACCAAAC[A/T,G]
GTGAATACATTCCAAGTGAAATCACGTCACTTATTGGCAGCAATTTTCCATGGAATGTTAGCTTTACACGGGATACTGTTATGAGAAGTCAAGAGTGCCT

Reverse complement sequence

AGGCACTCTTGACTTCTCATAACAGTATCCCGTGTAAAGCTAACATTCCATGGAAAATTGCTGCCAATAAGTGACGTGATTTCACTTGGAATGTATTCAC[T/A,C]
GTTTGGTGGATTTTCTTCAATGAGAGATTCTATGGGCCTGCGTAGTAGCCGTTGTGCGATCCTTCCGAAAAGGATAAATGTAGCATTAGCATCATCATCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.00% 18.30% 2.69% 0.00% G: 0.02%
All Indica  2759 98.30% 1.40% 0.22% 0.00% G: 0.04%
All Japonica  1512 44.80% 47.50% 7.67% 0.00% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 99.00% 0.70% 0.34% 0.00% NA
Indica II  465 98.50% 1.30% 0.22% 0.00% NA
Indica III  913 98.80% 1.10% 0.00% 0.00% G: 0.11%
Indica Intermediate  786 97.20% 2.40% 0.38% 0.00% NA
Temperate Japonica  767 48.40% 40.00% 11.60% 0.00% NA
Tropical Japonica  504 46.40% 51.00% 2.58% 0.00% NA
Japonica Intermediate  241 30.30% 63.90% 5.81% 0.00% NA
VI/Aromatic  96 28.10% 69.80% 2.08% 0.00% NA
Intermediate  90 70.00% 26.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318010651 A -> T LOC_Os03g31560.1 missense_variant ; p.Ser1318Cys; MODERATE nonsynonymous_codon ; S1318Y Average:44.37; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 probably damaging 2.305 DELETERIOUS 0.02
vg0318010651 A -> T LOC_Os03g31560.1 missense_variant ; p.Ser1318Cys; MODERATE nonsynonymous_codon ; S1318C Average:44.37; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 probably damaging 2.937 DELETERIOUS 0.01
vg0318010651 A -> G LOC_Os03g31560.1 missense_variant ; p.Ser1318Gly; MODERATE nonsynonymous_codon ; S1318G Average:44.37; most accessible tissue: Zhenshan97 flag leaf, score: 62.519 benign 1.208 DELETERIOUS 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318010651 NA 2.53E-11 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 5.98E-11 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 1.94E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 6.56E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 1.62E-12 mr1521 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 2.59E-07 mr1604 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 1.12E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 3.22E-07 mr1824 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 7.57E-07 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 5.06E-06 5.06E-06 mr1355_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 4.47E-06 4.47E-06 mr1360_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 4.02E-06 mr1576_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 9.85E-08 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318010651 NA 7.80E-10 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251