Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318003091:

Variant ID: vg0318003091 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 18003091
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

GTCAAAGCTTATGTTTCCAACTTTCCATGGCCATCTTTCTTCCTTTGTAGTTAGCCATAGATGTCTCTCATGTTTCCCTACTGAATATTGCTGTACGATA[G/A]
CTGATGCTTCTGACCCCTTCTTTTCTTTGGGAATTTCATTATGATGATAGGTTGCTTGCAGCCATAGAACTACTTGTTCCATCCATTGTTGTCCAAGTTG

Reverse complement sequence

CAACTTGGACAACAATGGATGGAACAAGTAGTTCTATGGCTGCAAGCAACCTATCATCATAATGAAATTCCCAAAGAAAAGAAGGGGTCAGAAGCATCAG[C/T]
TATCGTACAGCAATATTCAGTAGGGAAACATGAGAGACATCTATGGCTAACTACAAAGGAAGAAAGATGGCCATGGAAAGTTGGAAACATAAGCTTTGAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	31.70%	0.08%	0.00%	NA
All Indica	2759	97.20%	2.70%	0.07%	0.00%	NA
All Japonica	1512	14.60%	85.40%	0.00%	0.00%	NA
Aus	269	92.90%	7.10%	0.00%	0.00%	NA
Indica I	595	97.80%	2.20%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	98.20%	1.50%	0.22%	0.00%	NA
Indica Intermediate	786	95.70%	4.30%	0.00%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	39.50%	60.50%	0.00%	0.00%	NA
Japonica Intermediate	241	7.90%	92.10%	0.00%	0.00%	NA
VI/Aromatic	96	25.00%	75.00%	0.00%	0.00%	NA
Intermediate	90	53.30%	44.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0318003091	G -> A	LOC_Os03g31560.1	upstream_gene_variant ; 1365.0bp to feature; MODIFIER	silent_mutation	Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021	N	N	N	N
vg0318003091	G -> A	LOC_Os03g31550.1	downstream_gene_variant ; 4593.0bp to feature; MODIFIER	silent_mutation	Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021	N	N	N	N
vg0318003091	G -> A	LOC_Os03g31550.2	downstream_gene_variant ; 4593.0bp to feature; MODIFIER	silent_mutation	Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021	N	N	N	N
vg0318003091	G -> A	LOC_Os03g31550-LOC_Os03g31560	intergenic_region ; MODIFIER	silent_mutation	Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0318003091	NA	1.14E-09	mr1198	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	6.26E-21	mr1217	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	2.56E-08	mr1217	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	8.96E-12	mr1636	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	1.53E-08	mr1718	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	2.75E-06	9.81E-16	mr1750	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	9.18E-07	mr1830	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	3.41E-07	mr1845	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	7.87E-07	1.39E-13	mr1718_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	6.38E-07	3.35E-23	mr1750_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	9.43E-10	mr1784_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091	NA	2.07E-09	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251