\
| Variant ID: vg0318003091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 18003091 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 204. )
GTCAAAGCTTATGTTTCCAACTTTCCATGGCCATCTTTCTTCCTTTGTAGTTAGCCATAGATGTCTCTCATGTTTCCCTACTGAATATTGCTGTACGATA[G/A]
CTGATGCTTCTGACCCCTTCTTTTCTTTGGGAATTTCATTATGATGATAGGTTGCTTGCAGCCATAGAACTACTTGTTCCATCCATTGTTGTCCAAGTTG
CAACTTGGACAACAATGGATGGAACAAGTAGTTCTATGGCTGCAAGCAACCTATCATCATAATGAAATTCCCAAAGAAAAGAAGGGGTCAGAAGCATCAG[C/T]
TATCGTACAGCAATATTCAGTAGGGAAACATGAGAGACATCTATGGCTAACTACAAAGGAAGAAAGATGGCCATGGAAAGTTGGAAACATAAGCTTTGAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.20% | 31.70% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 97.20% | 2.70% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 14.60% | 85.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.20% | 1.50% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 39.50% | 60.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 25.00% | 75.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 44.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0318003091 | G -> A | LOC_Os03g31560.1 | upstream_gene_variant ; 1365.0bp to feature; MODIFIER | silent_mutation | Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 | N | N | N | N |
| vg0318003091 | G -> A | LOC_Os03g31550.1 | downstream_gene_variant ; 4593.0bp to feature; MODIFIER | silent_mutation | Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 | N | N | N | N |
| vg0318003091 | G -> A | LOC_Os03g31550.2 | downstream_gene_variant ; 4593.0bp to feature; MODIFIER | silent_mutation | Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 | N | N | N | N |
| vg0318003091 | G -> A | LOC_Os03g31550-LOC_Os03g31560 | intergenic_region ; MODIFIER | silent_mutation | Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0318003091 | NA | 1.14E-09 | mr1198 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 6.26E-21 | mr1217 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 2.56E-08 | mr1217 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 8.96E-12 | mr1636 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 1.53E-08 | mr1718 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | 2.75E-06 | 9.81E-16 | mr1750 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 9.18E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 3.41E-07 | mr1845 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | 7.87E-07 | 1.39E-13 | mr1718_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | 6.38E-07 | 3.35E-23 | mr1750_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 9.43E-10 | mr1784_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0318003091 | NA | 2.07E-09 | mr1800_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |