\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0318003091:

Variant ID: vg0318003091 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 18003091
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


GTCAAAGCTTATGTTTCCAACTTTCCATGGCCATCTTTCTTCCTTTGTAGTTAGCCATAGATGTCTCTCATGTTTCCCTACTGAATATTGCTGTACGATA[G/A]
CTGATGCTTCTGACCCCTTCTTTTCTTTGGGAATTTCATTATGATGATAGGTTGCTTGCAGCCATAGAACTACTTGTTCCATCCATTGTTGTCCAAGTTG

Reverse complement sequence

CAACTTGGACAACAATGGATGGAACAAGTAGTTCTATGGCTGCAAGCAACCTATCATCATAATGAAATTCCCAAAGAAAAGAAGGGGTCAGAAGCATCAG[C/T]
TATCGTACAGCAATATTCAGTAGGGAAACATGAGAGACATCTATGGCTAACTACAAAGGAAGAAAGATGGCCATGGAAAGTTGGAAACATAAGCTTTGAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.20% 31.70% 0.08% 0.00% NA
All Indica  2759 97.20% 2.70% 0.07% 0.00% NA
All Japonica  1512 14.60% 85.40% 0.00% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 97.80% 2.20% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 98.20% 1.50% 0.22% 0.00% NA
Indica Intermediate  786 95.70% 4.30% 0.00% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 39.50% 60.50% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 92.10% 0.00% 0.00% NA
VI/Aromatic  96 25.00% 75.00% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0318003091 G -> A LOC_Os03g31560.1 upstream_gene_variant ; 1365.0bp to feature; MODIFIER silent_mutation Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 N N N N
vg0318003091 G -> A LOC_Os03g31550.1 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 N N N N
vg0318003091 G -> A LOC_Os03g31550.2 downstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 N N N N
vg0318003091 G -> A LOC_Os03g31550-LOC_Os03g31560 intergenic_region ; MODIFIER silent_mutation Average:23.794; most accessible tissue: Minghui63 flower, score: 31.021 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0318003091 NA 1.14E-09 mr1198 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 6.26E-21 mr1217 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 2.56E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 8.96E-12 mr1636 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 1.53E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 2.75E-06 9.81E-16 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 9.18E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 3.41E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 7.87E-07 1.39E-13 mr1718_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 6.38E-07 3.35E-23 mr1750_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 9.43E-10 mr1784_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0318003091 NA 2.07E-09 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251