\
| Variant ID: vg0317967365 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17967365 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTTTCAGCGTGAGCCGTCTCCCCAGCTAGGAACGCGTCTACTCCGTGGGAGACGTGGCTCTACGCTAGGAGCACCAGCTTTTCGCAGAGAGTCGGGCCTC[G/T,A]
CTCCTGCGAGGAGACCCGCTGCATGCTCCCGTCTCCTCGCCGCTCCCCCCAAATCCCCCTCCAATCCTCGCCCCCTCGCCTCTCTCCCACGGAGCTACCC
GGGTAGCTCCGTGGGAGAGAGGCGAGGGGGCGAGGATTGGAGGGGGATTTGGGGGGAGCGGCGAGGAGACGGGAGCATGCAGCGGGTCTCCTCGCAGGAG[C/A,T]
GAGGCCCGACTCTCTGCGAAAAGCTGGTGCTCCTAGCGTAGAGCCACGTCTCCCACGGAGTAGACGCGTTCCTAGCTGGGGAGACGGCTCACGCTGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 5.90% | 0.02% | 0.00% | A: 0.21% |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.20% | 0.10% | 0.07% | 0.00% | A: 0.66% |
| Aus | 269 | 16.40% | 83.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 97.80% | 0.00% | 0.20% | 0.00% | A: 1.98% |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317967365 | G -> T | LOC_Os03g31540.1 | missense_variant ; p.Ser333Arg; MODERATE | nonsynonymous_codon ; S333R | Average:70.929; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | unknown | unknown | DELETERIOUS | 0.00 |
| vg0317967365 | G -> A | LOC_Os03g31540.1 | synonymous_variant ; p.Ser333Ser; LOW | synonymous_codon | Average:70.929; most accessible tissue: Zhenshan97 young leaf, score: 87.004 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317967365 | NA | 7.63E-12 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 2.12E-10 | mr1499 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 7.47E-07 | mr1530 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 2.57E-07 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 5.60E-11 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 1.72E-07 | mr1735 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 5.17E-06 | mr1952 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 2.26E-10 | mr1047_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | 5.23E-06 | NA | mr1151_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | 2.11E-07 | NA | mr1248_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | 2.03E-07 | NA | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 1.64E-21 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 1.86E-12 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 2.65E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 1.72E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | NA | 2.14E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317967365 | 2.82E-06 | NA | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |