\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317965477:

Variant ID: vg0317965477 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17965477
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


CCGTTACTCACAATTTTGAACTGGAAACTAGACAGGAAGTTCCGGACCTAGAAGACAGGAACTTCCGGACTACACTTAGGAAAATCTTTTTCATAAGACC[G/A]
GAACTTCCGGACCTGGAAGACATTAAGTTCCGGACTTGCACTTTTGGACAGATAGAGTATTTGCAAAAATGACTCCATAGGGAAACTTGACACTTGGTTC

Reverse complement sequence

GAACCAAGTGTCAAGTTTCCCTATGGAGTCATTTTTGCAAATACTCTATCTGTCCAAAAGTGCAAGTCCGGAACTTAATGTCTTCCAGGTCCGGAAGTTC[C/T]
GGTCTTATGAAAAAGATTTTCCTAAGTGTAGTCCGGAAGTTCCTGTCTTCTAGGTCCGGAACTTCCTGTCTAGTTTCCAGTTCAAAATTGTGAGTAACGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 40.40% 0.23% 0.00% NA
All Indica  2759 91.90% 7.90% 0.22% 0.00% NA
All Japonica  1512 13.40% 86.40% 0.13% 0.00% NA
Aus  269 8.20% 91.80% 0.00% 0.00% NA
Indica I  595 95.50% 4.20% 0.34% 0.00% NA
Indica II  465 97.00% 2.80% 0.22% 0.00% NA
Indica III  913 88.70% 11.20% 0.11% 0.00% NA
Indica Intermediate  786 89.80% 9.90% 0.25% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 36.30% 63.30% 0.40% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 47.80% 48.90% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317965477 G -> A LOC_Os03g31530.1 upstream_gene_variant ; 1678.0bp to feature; MODIFIER silent_mutation Average:29.413; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0317965477 G -> A LOC_Os03g31540.1 downstream_gene_variant ; 1852.0bp to feature; MODIFIER silent_mutation Average:29.413; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0317965477 G -> A LOC_Os03g31530-LOC_Os03g31540 intergenic_region ; MODIFIER silent_mutation Average:29.413; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317965477 NA 9.14E-06 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 8.48E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 1.01E-13 mr1218 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 2.35E-09 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 8.01E-21 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 8.78E-08 mr1718 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 1.17E-06 1.38E-16 mr1750 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 7.54E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 6.94E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 4.84E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 1.41E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 8.51E-10 8.51E-10 mr1987 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 7.93E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 4.38E-56 mr1109_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 3.68E-51 mr1121_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 1.28E-06 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 5.83E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 7.54E-13 mr1147_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 9.65E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 2.19E-06 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 5.15E-38 mr1251_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 2.04E-21 mr1255_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 7.61E-07 NA mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 7.46E-06 8.67E-32 mr1270_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 4.47E-26 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 5.89E-06 NA mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 3.62E-38 mr1435_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 8.57E-08 mr1612_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 1.05E-07 1.25E-16 mr1718_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 3.36E-16 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 1.49E-41 mr1745_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 5.16E-07 7.80E-25 mr1750_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 1.83E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 2.04E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317965477 NA 7.35E-14 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251