Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317919384:

Variant ID: vg0317919384 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17919384
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.24, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


CGCTGGCGTGGGCTGAGACGACGCCGTGTGCACGCGTGTGGTGGAGGCAGTGCGGCTGATAACGGCACAACACTCCTGTTAAATAGTCCCACATTGGTTG[A/G]
GGAAGGGTAAGAGACCTAATATATACGTAGGGGAGCCCCTCACCTCATTGGCTAGCTTTTTAGGGTGGGAAAAACCCTTTATAATCCTACAATTGGTATC

Reverse complement sequence

GATACCAATTGTAGGATTATAAAGGGTTTTTCCCACCCTAAAAAGCTAGCCAATGAGGTGAGGGGCTCCCCTACGTATATATTAGGTCTCTTACCCTTCC[T/C]
CAACCAATGTGGGACTATTTAACAGGAGTGTTGTGCCGTTATCAGCCGCACTGCCTCCACCACACGCGTGCACACGGCGTCGTCTCAGCCCACGCCAGCG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 23.10% 0.06% 0.00% NA
All Indica  2759 77.30% 22.60% 0.11% 0.00% NA
All Japonica  1512 87.10% 12.90% 0.00% 0.00% NA
Aus  269 13.40% 86.60% 0.00% 0.00% NA
Indica I  595 55.30% 44.50% 0.17% 0.00% NA
Indica II  465 81.10% 18.90% 0.00% 0.00% NA
Indica III  913 88.80% 11.00% 0.22% 0.00% NA
Indica Intermediate  786 78.40% 21.60% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 64.90% 35.10% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317919384 A -> G LOC_Os03g31440.1 upstream_gene_variant ; 3004.0bp to feature; MODIFIER silent_mutation Average:92.702; most accessible tissue: Zhenshan97 flower, score: 97.904 N N N N
vg0317919384 A -> G LOC_Os03g31446.1 downstream_gene_variant ; 3847.0bp to feature; MODIFIER silent_mutation Average:92.702; most accessible tissue: Zhenshan97 flower, score: 97.904 N N N N
vg0317919384 A -> G LOC_Os03g31440-LOC_Os03g31446 intergenic_region ; MODIFIER silent_mutation Average:92.702; most accessible tissue: Zhenshan97 flower, score: 97.904 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0317919384 A G 0.06 0.05 0.02 0.05 0.04 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317919384 NA 8.60E-08 Spikelet_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0317919384 NA 1.23E-06 mr1038 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 8.21E-06 mr1097 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 4.12E-07 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 2.02E-08 mr1215 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 8.48E-08 mr1217 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.50E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 3.15E-10 mr1307 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 5.84E-06 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 2.77E-06 mr1407 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 9.14E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 4.65E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.62E-07 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 3.93E-10 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.02E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 7.87E-06 mr1569 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 8.29E-08 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.56E-06 mr1681 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 6.17E-10 mr1735 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 8.14E-06 mr1735 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.96E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.08E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 7.54E-07 mr1830 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 6.94E-07 mr1845 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.41E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 5.20E-08 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.25E-07 mr1942 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 2.72E-08 mr1960 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 9.18E-08 mr1984 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 5.83E-09 mr1136_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 8.25E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317919384 NA 1.83E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251