\
| Variant ID: vg0317860149 (JBrowse) | Variation Type: SNP |
| Chromosome: chr03 | Position: 17860149 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 286. )
AAACTATTTTGATTTCTTTAGGGAATATCTCCTAGTTACCATTAAAATGGTCATGAAAAATTCTCAAAAATTTGATCACAAGATATCTCTGGAAGTAAAA[C/T]
ATTTCTATACTAGATGGTACCCTGTGCGTTGCTGCAAAAATTGGTAAGAAATATTCAACATGAAAAATATTATAGGTGATATATCTTAGGAGAAGTAGGA
TCCTACTTCTCCTAAGATATATCACCTATAATATTTTTCATGTTGAATATTTCTTACCAATTTTTGCAGCAACGCACAGGGTACCATCTAGTATAGAAAT[G/A]
TTTTACTTCCAGAGATATCTTGTGATCAAATTTTTGAGAATTTTTCATGACCATTTTAATGGTAACTAGGAGATATTCCCTAAAGAAATCAAAATAGTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 87.60% | 12.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 65.90% | 34.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0317860149 | C -> T | LOC_Os03g31340.1 | upstream_gene_variant ; 668.0bp to feature; MODIFIER | silent_mutation | Average:46.677; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0317860149 | C -> T | LOC_Os03g31360.1 | upstream_gene_variant ; 4129.0bp to feature; MODIFIER | silent_mutation | Average:46.677; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| vg0317860149 | C -> T | LOC_Os03g31340-LOC_Os03g31360 | intergenic_region ; MODIFIER | silent_mutation | Average:46.677; most accessible tissue: Zhenshan97 young leaf, score: 65.28 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0317860149 | NA | 4.56E-06 | mr1073 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317860149 | NA | 3.55E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317860149 | 1.23E-07 | 1.23E-07 | mr1362 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317860149 | NA | 1.19E-06 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317860149 | NA | 1.89E-07 | mr1696 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317860149 | NA | 7.54E-07 | mr1830 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0317860149 | 2.84E-06 | 2.97E-11 | mr1852 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |