Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317754398:

Variant ID: vg0317754398 (JBrowse)Variation Type: SNP
Chromosome: chr03Position: 17754398
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAACCATGTTTTTATTATGACATGCGAGGGGATTAATTAGAAGCCTGAGGTTGGAGTGAAATATTCCGTGTTCAGATACACTTAGACCGTGTTTAGTTA[C/T]
AAAGTTTTTCTTTTTTCAAATTTTTAACTTTTTCATCACATCATTTCAATTTCAACCAAACTTTTAATTTTAACATCAACTAAACACACCCTAATTACAA

Reverse complement sequence

TTGTAATTAGGGTGTGTTTAGTTGATGTTAAAATTAAAAGTTTGGTTGAAATTGAAATGATGTGATGAAAAAGTTAAAAATTTGAAAAAAGAAAAACTTT[G/A]
TAACTAAACACGGTCTAAGTGTATCTGAACACGGAATATTTCACTCCAACCTCAGGCTTCTAATTAATCCCCTCGCATGTCATAATAAAAACATGGTTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 35.50% 0.23% 0.00% NA
All Indica  2759 97.70% 2.20% 0.11% 0.00% NA
All Japonica  1512 1.40% 98.30% 0.33% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 98.00% 1.80% 0.17% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 98.60% 1.40% 0.00% 0.00% NA
Indica Intermediate  786 96.70% 3.10% 0.25% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 3.40% 95.80% 0.79% 0.00% NA
Japonica Intermediate  241 0.80% 98.80% 0.41% 0.00% NA
VI/Aromatic  96 12.50% 86.50% 1.04% 0.00% NA
Intermediate  90 52.20% 45.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0317754398 C -> T LOC_Os03g31180.1 upstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:91.175; most accessible tissue: Zhenshan97 young leaf, score: 94.734 N N N N
vg0317754398 C -> T LOC_Os03g31180.2 upstream_gene_variant ; 419.0bp to feature; MODIFIER silent_mutation Average:91.175; most accessible tissue: Zhenshan97 young leaf, score: 94.734 N N N N
vg0317754398 C -> T LOC_Os03g31180.3 upstream_gene_variant ; 3431.0bp to feature; MODIFIER silent_mutation Average:91.175; most accessible tissue: Zhenshan97 young leaf, score: 94.734 N N N N
vg0317754398 C -> T LOC_Os03g31170-LOC_Os03g31180 intergenic_region ; MODIFIER silent_mutation Average:91.175; most accessible tissue: Zhenshan97 young leaf, score: 94.734 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0317754398 C T 0.0 0.0 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0317754398 NA 1.07E-33 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 2.16E-11 7.10E-93 mr1718 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 4.12E-18 8.14E-164 mr1750 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 NA 1.20E-16 mr1842 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 NA 3.50E-39 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 NA 1.83E-67 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 8.03E-07 2.41E-117 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 NA 3.34E-36 mr1689_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 1.72E-14 5.53E-135 mr1718_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 4.29E-29 8.42E-234 mr1750_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317754398 2.57E-07 5.36E-159 mr1987_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251