Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0317750910:

Variant ID: vg0317750910 (JBrowse)	Variation Type: SNP
Chromosome: chr03	Position: 17750910
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTAGATCTGAGATTTTGTAAAAATAGGTATGGTATTTTATAATGAATATTTAGACCCTTAAATGACCTCAAATAATAAAATAGTCAATAATAAATTTGTA[G/T]
ATTTCATCGAGCTCTACAATTTTGATATAAAGTTTGTCTTCATCTGACTTCATATGAAAAAGTTGTATATATACGTGTTTTTTCTAAAATTTGATCCATG

Reverse complement sequence

CATGGATCAAATTTTAGAAAAAACACGTATATATACAACTTTTTCATATGAAGTCAGATGAAGACAAACTTTATATCAAAATTGTAGAGCTCGATGAAAT[C/A]
TACAAATTTATTATTGACTATTTTATTATTTGAGGTCATTTAAGGGTCTAAATATTCATTATAAAATACCATACCTATTTTTACAAAATCTCAGATCTAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.30%	35.60%	0.13%	0.00%	NA
All Indica	2759	97.80%	2.00%	0.18%	0.00%	NA
All Japonica	1512	1.30%	98.70%	0.00%	0.00%	NA
Aus	269	98.10%	1.90%	0.00%	0.00%	NA
Indica I	595	98.20%	1.50%	0.34%	0.00%	NA
Indica II	465	97.40%	2.60%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	96.90%	2.70%	0.38%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.80%	99.20%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	48.90%	50.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0317750910	G -> T	LOC_Os03g31170.1	upstream_gene_variant ; 2349.0bp to feature; MODIFIER	silent_mutation	Average:28.229; most accessible tissue: Minghui63 flower, score: 35.234	N	N	N	N
vg0317750910	G -> T	LOC_Os03g31180.1	upstream_gene_variant ; 3908.0bp to feature; MODIFIER	silent_mutation	Average:28.229; most accessible tissue: Minghui63 flower, score: 35.234	N	N	N	N
vg0317750910	G -> T	LOC_Os03g31170.3	upstream_gene_variant ; 2349.0bp to feature; MODIFIER	silent_mutation	Average:28.229; most accessible tissue: Minghui63 flower, score: 35.234	N	N	N	N
vg0317750910	G -> T	LOC_Os03g31170.2	upstream_gene_variant ; 2349.0bp to feature; MODIFIER	silent_mutation	Average:28.229; most accessible tissue: Minghui63 flower, score: 35.234	N	N	N	N
vg0317750910	G -> T	LOC_Os03g31180.2	upstream_gene_variant ; 3907.0bp to feature; MODIFIER	silent_mutation	Average:28.229; most accessible tissue: Minghui63 flower, score: 35.234	N	N	N	N
vg0317750910	G -> T	LOC_Os03g31170-LOC_Os03g31180	intergenic_region ; MODIFIER	silent_mutation	Average:28.229; most accessible tissue: Minghui63 flower, score: 35.234	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0317750910	NA	4.39E-14	mr1376	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	4.39E-14	mr1431	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	1.59E-35	mr1670	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	9.76E-13	3.26E-93	mr1718	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	8.34E-23	1.18E-167	mr1750	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	2.58E-17	mr1842	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	1.50E-06	mr1850	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	4.27E-42	mr1873	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	3.04E-55	mr1889	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	8.06E-69	mr1896	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	5.31E-79	mr1907	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	5.27E-51	mr1935	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	1.01E-08	2.07E-119	mr1987	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	3.16E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	1.43E-11	1.32E-132	mr1718_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	1.77E-19	6.39E-220	mr1750_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	5.12E-16	mr1842_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0317750910	NA	2.62E-153	mr1987_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251